Apta-Index™ (Aptamer Database)

Peptide Protein Affinity (Kd) N/A nM In vivo mice. Contains WAR epitope believed to suppress migration of VEGF-stimulated HUVECs, resulting in suppression of tumor growth.
See also ASS peptide , which also results in suppression of tumor growth.
See also PVV peptide , which is mentioned in the same article, and also results in tumor growth suppression. 5'-AspArgTrpArgProAlaLeuProValValLeuPheProLeuHis-3' 15 2006.41 Asai et al. "Isolation of a Novel Peptide Homing to Tumor-Derived Neovasculature That Suppresses Tumor Growth." Biological Pharmaceutical Bulletin, 25(2002): 904-906.

Peptide Protein Affinity (Kd) 4.58 µM 0.1 M NaCO₃, pH 8.6 The biotin-labeled peptide bound to the TNC positive cell lines U251 and U11MG (glioblastoma). It did not bind to the TNC negative control cell lines HT29 and HCT116 (colorectal cancer). 5'-PheHisLysHisLysSerProAlaLeuSerProValGlyGlyGly-3' 15 1708.99 M Y Kim et al. Selection and Characterization of Tenascin C Targeting Peptide. Mol. Cells 33(2012): 71-77.

DNA Protein Affinity (Kd) 5.8 nM 10 mM Tris, 0.5 mM NaCl, 1 mM EDTA, pH 7.4 Main aptamer: 80°C for 3 minutes, gentle cooling at 23°C for 5 minutes. Antisense Apta-switch component: 40°C for 10 minutes, then combine with refolded main aptamer and incubate for 2 hours at 23°C. Wash with 1X DPBS, store at 4°C. Apta-switch component (antisense strand) to SARS-CoV Spike protein aptamer (ID #: 7058). Originally reported with poly(dT) spacer and linker for functionalization. 5'-dTpdGpdTpdCpdCpdApdTpdTpdApdApdCpdGpdCpdCpdCp-3' 15 Singh NK, Ray P, Carlin AF, Magallanes C, Morgan SC, Laurent LC, Aronoff-Spencer ES, Hall DA. "Hitting the diagnostic sweet spot: Pont-of-care SARS-CoV-2 salivary antigen testing with an off-the-shelf gluocometer". medRxiv preprint. doi: https://doi.org/10.1101/2020.09.24.20200394.

DNA Protein LOD 0.3 fM 0.1 M Na2HPO4, 0.1 M KH2PO4 and 0.1 M NaCl. 20 mM Tris–HCl buffer (pH 7.4) containing 140 mM NaCl, 5 mM KCl and 1 mM MgCl2 mFold N/A Modified Thrombin Aptamer. 5' SH-(CH2)6−GGTTGGTGTGGTTGG '3 SH-(CH2)6-dGpdGpdTpdTpdGpdGpdTpdGpdTpdGpdGpdTpdTpdGpdGp 15 5039.41 142641 doi:10.1016/j.aca.2013.09.060

DNA Protein Affinity (Kd) 123.1 nM Using T4 PNK (Stratagene) for 45 min at 37C in PNK buffer (Stratagene). In the presence of different concentrations of aptamers (0–1500 nm), human a-thrombin (2.5 NIH units per mL; CellSystems) and UFH (0.01 UmL^-1; Liquemin, Roche) were incubated in assay buffer (1x PBS, pH 7.4, 3 mm MgCl2, 1 mg mL^-1 BSA) for 5 min at room temperature in a total volume of 100 uL. Human thrombin-specific, a promising therapeutic measure in the treatment of patients with arterial and venous thromboembolism. 5'-dGpdGpdTpdTpdGpdGpdTpdGpdTpdTpdGpdTpdTpdGpdGp-3' 15 4701.1 141300 Müller, J., Wulffen, B., Pötzsch, B., & Mayer, G. (2007). Multidomain Targeting Generates a High-Affinity Thrombin-Inhibiting Bivalent Aptamer. ChemBioChem, 8(18), 2223–2226. doi:10.1002/cbic.200700535

DNA Small Organic Affinity (Kd) 55-87 µM Nuclear Magnetic Resonance Spectroscopy (NMR), High Sensitivity Isothermal Titration Calorimetry (ITC), Circular Dichroism Spectroscopy (CD) Buffer: NaCl/sodium phosphate buffer β1-adrenergic receptor (β1-AAB) among GPCR-AABs, which are prevalent throughout dilated cardiomyopathy (DCM). Aptamer BC 007, originally developed as a thrombin inhibitor, has been identified as an efficient binder to critical SARS-CoV-2 proteins, including the RBD of the spike protein and RdRp. This suggests potential for repurposing BC 007 as a therapeutic agent against COVID-19. For kd affinity, the HRFYRLAN peptide sequence showed the highest affinity with Kd = 54.7 μM, followed by the peptide sequence YRLFRK with Kd = 86.7 μM 5'-dGpdGpdTpdTpdGpdGpdTpdGpdTpdGpdGpdTpdTpdGpdGp-3' 15 4726.1 g/mole 143300 (L)/(mole·cm) Weisshoff, H., Krylova, O., Nikolenko, H., Düngen, H. D., Dallmann, A., Becker, S., Göttel, P., Müller, J., & Haberland, A. (2020). Aptamer BC 007 - Efficient binder of spreading-crucial SARS-CoV-2 proteins. Heliyon, 6(11), e05421. https://doi.org/10.1016/j.heliyon.2020.e05421 Werner, S., Wallukat, G., Becker, N. P., Wenzel, K., Müller, J., Schimke, I., & Wess, G. (2020). The aptamer BC 007 for treatment of dilated cardiomyopathy: evaluation in Doberman Pinschers of efficacy and outcomes. ESC heart failure, 7(3), 844–855. https://doi.org/10.1002/ehf2.12628

Peptide Cells Affinity (Kd) N/A nM N/A Crosses cell membranes through an energy-independent mechanism. 5'-ArgGlnIleLysIleTrpPheGlnAsnArgArgMetLysTrpLysLys-3' 16 2455.04 Derossi D, Joliot A, Chassaing G, and Prochiantz A. (1994) The third helix of the Antennapedia homeodomain translocates through biological membranes. J. Biol. Chem. 269: 10444-10450.

DNA Small Organic Affinity (Kd) 77.22 ± 11.27 nM 200mL binding buffer: 50 mM Tris-HCl containing 5 mM KCl, 100 mM NaCl and 1 mMMgCl2, pH 7.4 NA 5'-dCpdTpdGpdTpdTpdTpdGpdGpdTpdApdGpdGpdCpdApdGp -3' 16 4639 143000 Wei, Hao et al. “Screening and application of a truncated aptamer for high-sensitive fluorescent detection of metronidazole.” Analytica chimica acta vol. 1128 (2020): 203-210. doi:10.1016/j.aca.2020.07.003

DNA Other Affinity (Kd) nM 15 μL of NaCl solution (0.5 mM), 30 μL of aptamer (1 μM) mFold Highly specific, mutant versions (M4, M16, and M4-16) of this aptamer are even more so. This aptamer is a Pb^2 binding aptamers with mutant versions designated as M4, M16, and M4-16. Most of its binding ability was determined in silico. The calculated binding free energy of this aptamer to Pb^2 is −1397.01 kj /mol. 5'-dGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdTp-3' 16 5105.28 157200 https://doi.org/10.1016/j.molliq.2019.111159.

DNA Other Affinity (Kd) nM 15 μL of NaCl solution (0.5 mM), 30 μL of aptamer (1 μM) mFold Highly specific, more specific than its original aptamer T30695. This aptamer is a Pb^2 binding aptamer that is a mutant variation of T30695. The other mutant variants are designated as M16, and M4-16. Most of its binding ability was determined in silico. The calculated binding free energy of this aptamer to Pb^2 is −1483.39 −kj /mol. 5'-dGpdGpdGpdApdGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdTp-3' 16 5114.29 161700 https://doi.org/10.1016/j.molliq.2019.111159.

DNA Other Affinity (Kd) nM 15 μL of NaCl solution (0.5 mM), 30 μL of aptamer (1 μM) mFold Highly specific, mutant versions (M4, M16, and M4-16) of this aptamer are even more so. This aptamer is a Pb^2 binding aptamer that is a mutant variation of T30695. The other mutant variants are designated as M4, and M4-16. Most of its binding ability was determined in silico. The calculated binding free energy of this aptamer to Pb^2 is −1417.17−kj /mol. 5'-dGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdAp-3' 16 https://doi.org/10.1016/j.molliq.2019.111159.

DNA Other Affinity (Kd) nM 15 μL of NaCl solution (0.5 mM), 30 μL of aptamer (1 μM) N/A Structure could not be determined Highly specific This aptamer is a Pb^2 binding aptamer that is a mutant variation of T30695. The other mutant variants are designated as M4, and M16. Most of its binding ability was determined in silico. The calculated binding free energy of this aptamer to Pb^2 is −1417.17−kj /mol. 5'-dGpdGpdGpdApdGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdAp-3' 16 5123.31 166900 https://doi.org/10.1016/j.molliq.2019.111159.

RNA Protein Affinity (Kd) 83.2 ± 82.9 nM m-Fold 5'-rCprCprCprUprCprCprUprAprCprAprUprAprGprGprGp-3' 17 4710.86 140700 Shigdar, S. et al. Nov 19, 2012. "RNA aptamers targeting cancer stem cell marker CD133." Elsevier. Cancer Letters.

Peptide Protein Affinity (Kd) Oct-60 µM AF-6 medium , mannitol (0.3 M) N/A <10 fold against Kuzuko starch Peptide Aptamer Sequence: Met-Thr-Thr-Cys-Ala-Arg-Arg-Phe-Arg-Ukn-Ile-Gly-Trp-Arg-Phe-Cys-Ser-Trp Identified by ribosome display, synthesized by solid-phase chemistry MetThrThrCysAlaArgArgPheArgUknIleGlyTrpArgPheCysSerTrp 18 1. Takanori Maeno, Takanori Uzawa, Izumi Kono, Kazunori Okano, Takanori Iino, Keisuke Fukita, Yuki Oshikawa, Taro Ogawa, Osamu Iwata, Takuro Ito, Kengo Suzuki, Keisuke Goda, Yoichiroh Hosokawa. Targeted delivery of fluorogenic peptide aptamers into live microalgae by femtosecond laser photoporation at single-cell resolution. Scientific Reports, 2018; 8 (1) DOI: 10.1038/s41598-018-26565-4

DNA Cells Affinity (Kd) 265 nM 4.5 g L−1 glucose, 5 mM MgCl2, 1 mg mL−1 bovine serum albumin (BSA) and 0.1 mg mL−1 yeast tRNA in 0.01 M PBS Denatured in binding buffer at 95 °C for 5 min and quickly cooled on ice for 10 min Binding to cell lines: KYSE150, other ESCCNo binding to: hepatocellular cancer cell line (SMMC-7721), gastric cancer cell line (SNU-5), lung cancer cell line (EBC-1), breast cancer cell line (MCF-7) and embryonic esophageal cell line (SHEE) 5'-dApdTpdGpdGpdCpdCpdApdGpdGpdGpdGpdGpdGpdApdGpdGpdGpdGp-3' 18 5710.7 184000 Chen, X., Zhang, Y., Shi, Y., Niu, T., Li, B., & Guo, L. et al. (2021). Evolution of DNA aptamers against esophageal squamous cell carcinoma using cell-SELEX. The Analyst, 146(13), 4180-4187. doi: 10.1039/d1an00634g

DNA Protein Affinity (Kd) nM Internalized to cells grown in DMEM, 15% FBS, 1% non-essential amino acids (NEAA) (Fujifilm Wako Chemicals), 1% nucleosides (Merck, Darmstadt, Germany), 0.1 mM 2-mercaptoethanol (Nacalai), 103 units/mL LIF (Nacalai), 3 uM CHIR99021 (FujifilmWako Chemicals), 0.8 uM PD0325901 (FujifilmWako Chemicals), and P/S N/A Binding affinity not determined in Ishioka et al., 2023. Authors state that "[the aptamer] forms a guanine quadruplex-like structure". 5'-dAsdGsdAsdTsdTsdAsdGsdGsdGsdTsdGsdAsdGsdGsdGsdTsdGsdAs-3' 18 5956.8 193500 Ishioka M, Nihashi Y, Sunagawa Y, et al. Myogenetic Oligodeoxynucleotide Induces Myocardial Differentiation of Murine Pluripotent Stem Cells. Int J Mol Sci. 2023;24(18):14380. Published 2023 Sep 21. doi:10.3390/ijms241814380

DNA Small Organic Affinity (Kd) 50 nM R buffer (20 mM HEPES (pH 7.4), 140 mM potassium acetate, 20 mM sodium acetate, 3 mM magnesium acetate) 5'-dCpdCpdCpdTpdApdGpdTpdTpdApdGpdCpdCpdApdTpdCpdTpdCpdCpdCp-3' 19 5659.71 166500 Sekkai et al. "In Vitro Selection of DNA Aptamers Against the HIV-1 TAR RNA Hairpin." Antisense and Nucleic Acid Drug Development, 12 (2002): 265-274.

Peptide Cells IC50 0.6 µM Binding Buffer (0.5% (v/v) Tween20, 0.5% BSA in PBS) NH2-GlyGlyAsnGluCysAspAlaIleArgMetTrpGluTrpGluCysPheGluArgLeu-COOH 19 2606.94 Pan et al. "Solution structure of a phage-derived peptide antagonist in complex with vascular endothelial growth factor." J Mol Biol, 316(2002): 769-787.

RNA Cells Affinity (Kd) 8.5 nM Selection Buffer (used for Filter Retention Assay): 137 mM NaCl, 2.7 mM KCl, 6.5 mM Na₂HPO₄, and 3 mM MgCl₂ at PH 7.5. None Listed No binding to IL-6 or lysozyme observed. Forms a G-quartet structure.
This aptamer is a truncated version of AIR-3 and binds to IL-6r presenting cells. It is then internalized and was used by Meyer et al. do deliver fluorescently labeled strptavidin. 5'-rGprGprGprGprAprGprGprCprUprGprUprGprGprUprGprAprGprGprGp-3' 19 6307.88 193400 Meyer C, U Hahn, et al. (2012) Interleukin-6 Receptor specific RNA aptamers for cargo delivery into target cells. RNA Biol

DNA Small Organic Affinity (Kd) 13.4 nM Binding Buffer: 20mM Tris-HCl (pH 8.0), 50 mM NaCl, 5 mM KCl, 5 mM MgCl₂. Heated at 90°C for 3 min and then cooled at 4°C for 1 hour. Did not bind to related antibiotics amoxicillin and benzylpenicillin, or unrelated antibiotics chloramphenicol, tetracycline, sulfadimethoxine, streptomycin, and kanamycin. Because of AMP17's ability to aggregate on gold nanoparticles at lower salt concentrations than the other two aptamers, AMP17 was further evaluated in a colorimetric-fluorometric assay. 5'-dGpdCpdGpdGpdGpdCpdGpdGpdTpdTpdGpdTpdApdTpdApdGpdCpdGpdGp-3' 19 5940.9 183800 Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161.

DNA Small Organic Affinity (Kd) 9.8 nM Binding Buffer: 20mM Tris-HCl (pH 8.0), 50 mM NaCl, 5 mM KCl, 5 mM MgCl₂. Heated at 90°C for 3 min and then cooled at 4°C for 1 hour. Only AMP17 was evaluated for specificity. 5'-dTpdTpdTpdApdGpdTpdTpdGpdGpdGpdGpdTpdTpdCpdApdGpdTpdTpdGp-3' 19 5895.91 180800 Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161.

RNA Cells Affinity (Kd) 39.89 nM PBS containing 5 mM MgCl2 NA 5'-rAprCprGprUprAprUprCprCprCprUprUprUprUprCprGprCprGprUprAp-3' 19 5631.6 165300 Bell DR, Weber JK, Yin W, Huynh T, Duan W, Zhou R. In silico design and validation of high-affinity RNA aptamers targeting epithelial cellular adhesion molecule dimers. Proc Natl Acad Sci U S A. 2020 Apr 14;117(15):8486-8493. doi: 10.1073/pnas.1913242117. Epub 2020 Mar 31. Erratum in: Proc Natl Acad Sci U S A. 2021 Feb 16;118(7): PMID: 32234785; PMCID: PMC7165443.

DNA Small Organic Affinity (Kd) 36 nM 10% saliva in 10 mM Tris, 0.1 mM MgCl2, pH 7.4 N/A Demonstrated specificity to cocaine over benzoylecgonine, anhydroecgonine methyl ester, cocaethylene and nicotine The sequence below is one fragment of the cocaine split aptamer that contains two separate fragments, please view "Related Aptamers" for second fragment of the sequence. "X" in sequence stands for C3 Spacer 5'-dGpdApdGpdApdCpdApdApdGpdGpXlkdGpdApdCpdApdApdGpdGpdApdGp-3' 19 5793.8 198200 Yu, H., Canoura, J., Guntupalli, B., Lou, X., & Xiao, Y. (2017). A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva. Chemical Science, 8(1), 131–141. doi:10.1039/c6sc01833e

RNA Protein Affinity (Kd) 145.1±75.4 nM m-Fold 5'-rCprAprGprAprAprCprGprUprAprUprAprCprUprAprUprUprCprUprGp-3' 19 6006.61 194200 Shigdar, S. et al. Nov 19, 2012. "RNA aptamers targeting cancer stem cell marker CD133." Elsevier. Cancer Letters.

DNA Small Organic Affinity (Kd) 9.8 nM The ssDNA library (500 pmol) was pre-incubated for 3 min at 90 °C and immediately cooled for 1 h at 4 °C in 100 μL of binding buffer (20 mM Tris–HCl, 50 mM NaCl, 5 mM KCl, 5 mM MgCl2, pH 8.0) to stabilize the naturally occurring tertiary structure. Similar structured small antibiotics amoxicillin and benzylpenicillin do not bind to the aptamer. Paper lists multiple aptamer sequences for binding the same molecule: AMP4 (21-mer 5′-CACGGCATGGTGGGCGTCGTG-3′) Kd-9.4nM AMP17 (19-mer 5′-GCGGGCGGTTGTATAGCGG-3′) Kd 13.4nM Multiple other references that cite this paper use the main sequence in this entry for their applications. 5'-dTpdTpdApdGpdTpdTpdGpdGpdGpdGpdTpdTpdCpdApdGpdTpdTpdGpdGp-3' 19 Song KM, Jeong E, Jeon W, Cho M, Ban C. Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 2012 Feb;402(6):2153-61. doi: 10.1007/s00216-011-5662-3. Epub 2012 Jan 7. PMID: 22222912. https://pubmed.ncbi.nlm.nih.gov/28917799/

2'-F-RNA Protein Affinity (Kd) 54.5 nM Assay Buffer: DPBS with 5 mM MgCl₂, 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA, 02% [w/v] sodium azide, and 5% FCS. The final concentration of MgCl₂ was 2.5 mM. Binds to the EpCAM positive cell lines: Kato III(Kd = 54.5 nM), MCF-7(50 nM), SW480 (69.2 nM), T47D (74.2 nM), HT-29 (158 nM), and MDA-MB-231 (98.9 nM).
Does not bind to: HEK-293T (Kd > 1000 nM), SK-N-DZ (>1000 nM), and K562 (>1000 nM). This aptamer is a modified version of Truncated Clone D. Also, it appears to be internalized via clathrin-dependent endocytosis following binding. See ref. for more details. 5'-rGpfCprGprApfCpfUprGprGpfUpfUp rApfCpfCpfCprGprGpfUpfCprGpdTi-3' 20 6392.85 188200 S Shigdar et al. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci 102(2011): 991-998.

DNA Protein Affinity (Kd) 29 nM Binding buffer: 20 mM Tris-AcOH (pH 8.0), 100 mM NaCl, 200 mM KCl, 5 mM MgCl₂, 0.5% Triton X-100, and 5% DMSO.

Peroxidase activity was measured using the ABTS-H₂O₂ system. Heated at 95°C for 5 min in 40KT buffer, cooled on ice for 5 min, and placed at RT.

40KT buffer: 50 mM MES (pH 6.5), 100 mM Tris acetate, 40 mM potassium acetate, 1% DMSO, and 0.05% Triton X Forms a G-quadruplex structure that enhances the natural peroxidase activity of hemin 5'-dApdTpdTpdGpdGpdGpdApdGpdGpdGpdApdTpdTpdGpdGpdGpdTpdGpdGpdGp-3' 20 6349.19 203600 Zhu L, et al. (2012) In vitro selection of highly efficient G-quadruplex-based DNAzymes. Anal. Chem. 84: 8383-8390.

DNA Protein Affinity (Kd) 12.37 nM 4.5 g/L glucose, 5 mM MgCl2, 0.1 mg/ml yeast tRNA and 1 mg/ml Bovine Serum Albumin (BSA) into Phosphate buffered saline (PBS) 5'-dGpdApdCpdGpdCpdTpdTpdApdCpdTpdCpdApdGpdGpdTpdGpdTpdGpdApdCpdTpdCpdGpdApdApdGpdGpdGpdGpdTpdTpdGpdGpdGpdTpdGpdGpdGpdTpdTpdTpdApdTpdApdCpdApdApdApdTpdTpdApdApdTpdTpdApdApdTpdApdTpdTpdGpdTpdApdTpdGpdGpdTpdApdTpdApdTpdTpdTpdCpdGpdApdApdGpdGpdApdCpdGpdCpdApdGpdApdTpdGpdApdApdGpdTpdCpdTpdCp-3' 20 29566.33 946000 Yang, M. et al. "Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery." Journal of Hematology & Oncology 2014, 7:5.

2'-F-RNA Other Affinity (Kd) . nM 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 80C for 10 min, and cooled down slowly to 4C Binding activity measured by fluorescence intensity within referenced paper. Due to presence of 2'F-CTP and 2'F-UTP, secondary structure may be inaccurate. 5'-fCpfUpfUprAprGpfCpfCpfCprApfUprAprGpfCpfUprGprGpfCpfUprGpfCp-3' 20 6342.71 320500 Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Method. Biol. Pharm. Bull. 37(8) 1411-1415 (2014). doi: 10.1248/bpb.b14-00112

DNA Protein Affinity (Kd) 23.58 nM 50 mM NaH2PO4, pH 8; 150 mM NaCl; 5 mM KCl; 2 mM MgCl2; and 0.05% Tween-20; RT. Heated to 95°C for 5 minutes, cooled to 4°C, then brought to RT for 30 minutes. Sequence is not confirmed. Secondary structure is of sequence presented in Supplemental Information. Listed sequence (below) is what is presented in main text. 5’-dGpdTpdTpdGpdApdCpdGpdGpdGpdCpdGpdApdTpdTpdGpdGpdTpdCpdTpdTp-3’ 20 6195.08 206430 Tsao, Shih-Ming, et al. “Generation of aptamers from a primer-free randomized ssDNA library using magnetic-assisted rapid aptamer selection.” Scientific Reports 7, (2017): 1-11.

DNA Protein Affinity (Kd) n/a nM Buffer 1: Tris buffer pH 7.3, 0.1% Tween-20, DMEM, 0.1% Tween-20 Buffer 2: Phosphate buffer pH 7.5, 0.1% Tween-20 Low affinity aptamers were removed from the column using both buffers. 5'-dApdCpdApdGpdTpdApdApdCpdCpdGpdCpdGpdTpdGpdApdGpdGpdTpdCpdGpdAp-3' 21 6480.27 212600 Haberland, A., et al. "Aptamer Neutralization of Beta1-Adrenoceptor Autoantibodies Isolated From Patients With Cardiomyopathies." Circulation Research, 109 (2011): 986-992.

DNA Small Organic Affinity (Kd) 9.4 nM Binding Buffer: 20mM Tris-HCl (pH 8.0), 50 mM NaCl, 5 mM KCl, 5 mM MgCl₂. Heated at 90°C for 3 min and then cooled at 4°C for 1 hour. Only AMP17 was evaluated for specificity. 5'-dCpdApdCpdGpdGpdCpdApdTpdGpdGpdTpdGpdGpdGpdCpdGpdTpdCpdGpdTpdGp-3' 21 6519.26 196500 Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161.

DNA Protein Affinity (Kd) 0.0182 nM N/A N/A Counter target is Ochratoxin A affinity in this paper was determined by cyclic voltammetry and measured current Vs E/V. Kd was determined by finding the highest peak and converting its concentration of aptamer and target to nM of target. Aptamer sequence is shorter than most. The Nguyen et al. paper claims it came from a university in Vietnam but cites no paper for further investigation into its length. 5'-dApdCpdTpdGpdCpdTpdApdGpdApdGpdApdTpdTpdTpdTpdCpdCpdApdCpdApdTp-3' 21 6380.23 201700 Nguyen. Label Free detection of Aflatoxin M1 with electrochemical Fe3O4/polyaniline-based aptasensor

DNA Other Affinity (Kd) 78.8 nM 20mM Tris-HCl, 50mM NaCl, 5mM KCl, 5mM MgCl2, pH 8.0 500pmole of ssDNA library dissolved in 100mL binding buffer and preincubated at 85C for 3 min, then 4C for 1 hour. dTpdGpdGp dGpdGpdGp dTpdTpdGp dApdGpdGp dCpdTpdAp dApdGpdCp dCpdGpdAp 21 6567.32 207500 Kyung-Mi Song, Minseon Cho, Hunho Jo, Kyoungin Min, Sung Ho Jeon, Taisun Kim, Min Su Han, Ja Kang Ku, Changill Ban, "Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer". Anal. Biochem. 415 (2011) 175-181.

DNA Other LOD 40 nM 3-(N-morpholino)propanesulfonic acid (10mM, pH 7.0, NaCl (25mM), NaNO₃ (500mM), and ethylenediamine (0.1 mM) Authors attached dabcyl (quencher) and 6-fluorescein (fluorophore) to the 5' and 3' ends of the aptamer. In the presence of Hg²⁺ ions, the aptamer forms a hairpin with T-Hg²⁺-T bonds. This brings the quencher into proximity of the fluorophore. 5'-dTpdTpdCpdTpdTpdTpdCpdTpdTpdCpdCpdCpdCpdTpdTpdGpdTpdTpdTpdGpdTpdTp-3' 22 6590.34 178600 A. Ono and H. Togashi. "Highly selective oligonucleotide-based sensor for mercury(II) in aqueous solutions." Angew. Chem. Int. Ed. 43(2004):4300-4302.

Peptide Protein Affinity (Kd) N/A nM Washed with cold PBS and glycine buffer added. Chilled on ice for 15 minutes. Inhibits CD59 expression; Concomitantly, sp22 increases complement-mediated lysis and apoptosis signals. 5'-AlaCysHisTrpProTrpCysHisGlyTrpHisSerAlaCysAspLeuProMetHisProMetCys-3' 22 2922.43 Li et al. "Identification of a novel short peptide seal specific to CD59 and its effect on HeLa cell growth and apoptosis." Cell Oncol. 35:355-365.

Chimeric Protein Affinity (Kd) 0.2 nM PBS with 1%BSA, 0.05% Tween 20, 5 mM MgCl2 [dGp][dGp][mCp][dAp][dGp][mGp][Bn-dUp][Bn-dUp][Pe-dUp][dGp][dGp][Nap-dUp][dAp][Bn-dUp][Bn-dUp][mAp][dAp][dCp][mAp][mCp][dGp][Bn-dUp][Bn-dUp][dAp][dAp][dGp][Bn-dUp][mCp][dGp][Bn-dUp][dGp][dGp] Refer to Figure in the publication and the visualization above for the sequence of the aptamer. Due to complex modifications to the sequence proposed by the publication authors, the structure of the aptamer cannot be estimated. dGpdGpdCpdApdGpdGpdGpdGpdApdApdApdCpdApdCpdGpdApdApdGpdCpdGpdGpdGp 22 6908.54 227300 Gupta, Shashi, et al. "Chemically modified DNA aptamers bind interleukin-6 with high affinity and inhibit signaling by blocking its interaction with interleukin-6 receptor." Journal of Biological Chemistry 289.12 (2014): 8706-8719.

2'-F-RNA Protein Affinity (Kd) 75 nM Binding Buffer (145mM NaCl, 5.4 mM KCl, 0.8mM MgCl, 1.8 mM CaCl, and 20 mM Tris-HCl (pH 7.6)) Modifications at the 5' and 3' end have been made by the authors for various testing. Specific for Human IgG, subclasses hIgG1 through hIgG4.
Does not bind to mouse, rat, rabbit, bovine, chicken, canine, feline, and guinea pig IgG. This aptamer binds to the Fc domain of hIgG.
See also the modified version of this aptamer, 8-2. 5'-rGprGprAprGprGpfUprGpfCpfUpfCpfCprGprAprAprAprGprGprAprApfCpfUpfCpfCp-3' 23 7442.54 226600 Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163.

Chimeric Protein Affinity (Kd) 90.9 nM Binding Buffer (145mM NaCl, 5.4 mM KCl, 0.8mM MgCl, 1.8 mM CaCl, and 20 mM Tris-HCl (pH 7.6)) Specific for Human IgG, subclasses hIgG1 through hIgG4.
Does not bind to mouse, rat, rabbit, bovine, chicken, canine, feline, and guinea pig IgG. This aptamer binds to the Fc domain of hIgG.
In picture of aptamer, lowercase letters are deoxynucleotide residues and uppercase letters are ribonucleotide or 2'-F-ribonucleotide residues. 5'-dGpdGprAprGprGpfUprGpdCpfUpdCpdCpdGpdApdApdAprGprGpdApdApfCpfUpdCpdCp-3' 23 7224.54 226000 Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163.

DNA Protein Affinity (Kd) 5.78 µM 1X PBS, 137mM [Na+], 2mM [Mg2+] Incubated at 65°C for 5 min followed by 4°C for 1 min Shows specific binding to only the Glycated form of human serum albumin 5'-dTpdGpdCpdGpdGpdTpdTpdGpdTpdApdGpdTpdApdCpdTpdCpdGpdTpdGpdGpdCpdCpdGp-3' 23 7102.65 213200 Apiwat et al. Graphene based aptasensor for glycated albuminin diabetes mellitus diagnosis and monitoring. Biosensors and Bioelectronics 82(2016)140ƒ??145.

DNA Protein Affinity (Kd) 68 nM TBS-T buffer for ELONA assay: 10 mM Tris-HCl, 150 mM NaCl, 5 mM KCl, pH 7.4 with 0.05% Tween 20. Heated to 95°C for 10 min, then cooled at a rate of 2°C/min to a final temperature of 25°C. Cross-reactivity with AD-specific amyloid ? oligomers (Kd=25 nM).

Does not bind to a-synuclein monomers or fibrils or PQQGDH, C-reactive protein, or luciferase. Weakly binds to IgG. CD spectrum suggests that this aptamer forms a G-quadruplex. 5'-dGpdCpdCpdTpdGpdTpdGpdGpdTpdGpdTpdTpdGpdGpdGpdGpdCpdGpdGpdGpdTpdGpdCpdGp-3' 24 7528.9 220200 K Tsukakoshi. Selection of DNA aptamers that recognize a-synuclein oligomers using a competitive screening method. Anal Chem. 84(2012): 5542-5547

DNA Protein Affinity (Kd) 1.72 µM 10 mM Tris pH 7.5, 10 mM MgCl2, 50 mM KCl, 25 mM NaCl The aptamer forms a G-Quadruplex 5'-dGpdGpdGpdTpdApdGpdCpdApdGpdApdTpdGpdGpdGpdGpdGpdGpdGpdGpdGpdGp-3' 24 7645 g/mole 245800 L/(mole·cm) Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14, (2008): 1154-1163. Kalra, P., et al. "G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells." Molecular Therapy: Nucleic Acids. Vol. 13. December 2018. https://doi.org/10.1016/j.omtn.2018.08.011

RNA Protein Affinity (Kd) 61 nM 20 mM Tris-HCl (pH 7.5) and 10 mM KCl N/A N/A 5'-rGprGprAprGprGprAprGprGprAprGprGprAprGprGprAprGprGprAprGprGprAprGprGprAp-3' 24 7790.05 Mashima, T., Lee, JH., Kamatari, Y.O. et al. Development and structural determination of an anti-PrPC aptamer that blocks pathological conformational conversion of prion protein. Sci Rep 10, 4934 (2020).

Mollasalehi N., Francois-Moutal L., Porciani D., Burke D.H., & Khanna M. (2022). Aptamers Targeting Hallmark Proteins of Neurodegeneration. Nucleic Acid Therapeutics, 32(4). https://doi.org/10.1089/nat.2021.0091

DNA Small Organic Affinity (Kd) 6 µM Column Buffer: 300 mM NaC1, 5 mM MgC1₂, 20 mM Tris (pH 7.6) Heated to 75°C for 5 min and then cooled to room temperature for 20-30 min. Forms a G-quartet 5'-dCpdCpdTpdGpdGpdGpdGpdGpdApdGpdTpdApdTpdTpdGpdCpdGpdGpdApdGpdGpdApdApdGpdGp-3' 25 7868.16 251000 Huizenga and Szostak. "A DNA Aptamer That Binds Adenosine and ATP." Biochemistry, 34 (1995): 656-665.

DNA Cells Affinity (Kd) N/A nM Washed with selection buffer (5 mM MgCl in PBS) from and 1 mg/ml yeast tRNAfor 30 minutes. Binding conditions from Wang et al. (2003) and truncated aptamer 17 (Aptamer 17a) from Liu et al. (2011). 5'-dGpdGpdTpdTpdGpdGpdApdTpdGpdTpdApdApdGpdGpdTpdTpdGpdGpdApdGpdGpdGpdGpdGpdGp-3' 25 7954.23 255700 Liu et al. "Dissection of the Functional Structure of Aptamer17, Which Specifically Recognizes Differential PC12 Cells." Nucleic Acid Therapeutics, 21(2011): 225-229.
Wang et al. "Single-stranded DNA Aptamers thatBbind Differentiated but not Parental Cells: Subtractive Systematic Evolution of Ligands by Exponential Enrichment." J. Biotechnol., 102(2003): 15-22.

DNA Protein Affinity (Kd) 1.1 nM 10% (v/v) human serum in TBSTE (TBSE containing 0.05% (v/v) of Tween-20). V7t1 is a truncated DNA aptamer that targets both VEGF-121 and VEGF-165. 5'-dTpdGpdTpdGpdGpdGpdGpdGpdTpdGpdGpdApdCpdGpdGpdGpdCpdCpdGpdGpdGpdTpdApdGpdAp-3' 25 7900.16 248000 Nonaka,Y., Sode, K., and Ikebukuro, K.(2010) "Screening and Improvement of an Anti-VEGF DNA Aptamer." Molecules, 15, 215-225.

DNA Protein Affinity (Kd) 1.4 nM 10% (v/v) human serum in TBSTE (TBSE containing 0.05% (v/v) of Tween-20). V7t1 is a truncated DNA aptamer that targets both VEGF-121 and VEGF-165. 5'-dTpdGpdTpdGpdGpdGpdGpdGpdTpdGpdGpdApdCpdGpdGpdGpdCpdCpdGpdGpdGpdTpdApdGpdAp-3' 25 7900.16 248000 Nonaka,Y., Sode, K., and Ikebukuro, K.(2010) "Screening and Improvement of an Anti-VEGF DNA Aptamer." Molecules, 15, 215-225.
Stejskalov?­, Anna & Oliva, Nuria & J England, Frances & Almquist, Benjamin. (2019). Biologically Inspired, Cell-Selective Release of Aptamer-Trapped Growth Factors by Traction Forces. Advanced Materials. 1806380. 10.1002/adma.201806380.

DNA Protein Affinity (Kd) 7 nM Selection Buffer: PBS, 0.005% (v/v) Tween-20. Does not bind to TNF??. This aptamer blocked TNFa signaling in a NF-?B luciferase reporter assays and also prevented TNFa-induced apoptosis and reduced NO production in cultured cells. 5'- dTpdGpdGpdTpdGpdGpdApdTpdGpdGp dCpdGpdCpdApdGpdTpdCpdGpdGpdCp dGpdApdCpdApdAp-3' 25 7788.1 244400 E Orava et al. A short DNA aptamer that recognizes TNFa and blocks its activity in vitro. ACS Chem. Biol. (2012) Accepted for print. DOI: 10.1021/cb3003557.

DNA Small Organic Affinity (Kd) 0.7 µM SB Buffer: 100 mM Tris-acetate (pH 7.4), 200 mM sodium acetate, 25 mM potassium acetate, 10 mM magnesium acetate, 0.5% Triton X-100, and 5% dimethyl sulfoxide. Heated to 90°C and then slowly cooled (over an hour) to room temperature. Kd listed is for NMM. Aptamer also binds to MPIX (Kd = 3.6 μM), Fe(III)-MPIX (2.6 μM), hemin (1.7 μM), Ni(II)-MPIX (3.6 μM), and Zn(II)-MPIX (4.9 μM). Thought to form a G-quartet 5'-dApdApdCpdGpdTpdGpdGpdGpdApdGpdGpdGpdCpdGpdGpdTpdGpdGpdTpdGpdTpdTpdGpdApdAp-3' 25 7883.18 253400 Y Li, CR Geyer, and D Sen. (1996) Recognition of anionic porphyrins by DNA aptamers. Biochem. 35:6911-6922.

DNA Protein Affinity (Kd) 0.135 nM PBS buffer (pH 7.2); Room Temperature (overnight) 5'-dGpdCpdApdGpdTpdTpdGpdApdTpdCpdCpdTpdTpdTpdGpdGpdApdTpdApdCpdCpdCpdTpdGpdGp-3' 25 7664.03 232300 D Seleci et al. Aptamer mediated niosomal drug delivery. RSC Adv 6(2016): 87910-87918.

DNA Protein Affinity (Kd) 0.010 - 1000 nM Bound to a gold electrode in order to transmit aptasensor data. This aptamer is intended to act as an Electrochemical Aptasenor. In order to function properly, the aptamer needs to be connected to a magnetic bead on the 5' terminus. 5'-dGpdCpdApdGpdTpdTpdGpdApdTpdCpdCpdTpdTpdTpdGpdGpdApdTpdApdCpdCpdCpdTpdGpdGp-3' 25 7743 Wen W., et al. "An insertion approach electrochemical aptasensor for mucin 1 detection based on exonuclease-assisted target recycling." Biosensors and Bioelectronics, 71 (2015): 13–17. doi: https://doi.org/10.1016/j.bios.2015.04.001

RNA Protein Affinity (Kd) N/A nM 20 mM Tris-HCl (pH 7.5) and 10 mM KCl N/A 5'-rGprGprAprGprGprAprGprGprAprGprGprAprAprGprGprAprGprGprAprGprGprAprGprGprAp-3' 25 8103.26 Mashima, T., Lee, JH., Kamatari, Y.O. et al. Development and structural determination of an anti-PrPC aptamer that blocks pathological conformational conversion of prion protein. Sci Rep 10, 4934 (2020).

DNA Protein Affinity (Kd) 7 nM A 96-well ELISA microtiter plate (BD Falcon) was coated overnight at 4 °C with 100 μL of human TNFα (10 μg/mL) prepared in coating buffer (0.2 M carbonate/bicarbonate, pH 9.4). The plate was then washed 3 times with PBS-T (0.1 M phosphate, 0.15 M sodium chloride, pH 7.0 containing 0.05% Tween-20) and blocked overnight at 4 °C in 150 μL of blocking solution (PBS-T + 1% (w/v) BSA). The plate was washed 3 times with PBS-T and incubated overnight at 4 °C with 100 μL (10 μg/mL) of 5′ biotinylated aptamers dissolved in PBS, 0.005% (v/v) Tween-20. The plates were washed and incubated for 1 h at 4 °C with 100 μL of streptavidin-HRP (1:2000). Plates were then read on a plate reader at 450 nm following washing and dispensing of 100 μL of TMB substrate (1 TMB tablet (Sigma-Aldrich Inc.) dissolved in 1 mL of DMSO in 10 mL of 0.05 M phosphate citrate, pH 5.0 and 2 μL sodium peroxide) per well. Color development was stopped by adding 50 μL of 1 M sulphuric acid per well. dTpdGpdGpdTpdGpdGpdApdTpdGpdGpdCpdGpdCpdApdGpdTpdCpdGpdGpdCpdGpdApdCpdApdAp 25 7788.1 g/mole 244400 L/(mole·cm) Orava EW, Jarvik N, Shek YL, Sidhu SS, Gariépy J. A short DNA aptamer that recognizes TNFα and blocks its activity in vitro. ACS Chem Biol. 2013 Jan 18;8(1):170-8. doi: 10.1021/cb3003557. Epub 2012 Oct 24. PMID: 23046187.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdTpdCpdCpdGpdGpdGpdGpdTpdApdApdGpdGpdGpdGpdApdGpdApdGpdGpdGpdGp-3' 25 7974.2 g/mole 257900 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

RNA Protein Affinity (Kd) N/A nM 20 mM Tris-HCl (pH 7.5) and 10 mM KCl N/A N/A N/A 5'-rGprGprAprGprGprAprGprGprAprGprGprAprAprGprGprAprGprGprAprGprGprAprGprGprAp-3' 25 8024.2 g/mole 281100 L/(mole·cm) Mashima, T., Lee, JH., Kamatari, Y.O. et al. Development and structural determination of an anti-PrPC aptamer that blocks pathological conformational conversion of prion protein. Sci Rep 10, 4934 (2020). https://doi.org/10.1038/s41598-020-61966-4

DNA Protein Affinity (Kd) N/A nM For fluoresecent labeling, 400 nM aptamer were added to cell growth media for 1 hour at 37°C and 5% CO₂. Dulbecco's phosphate-buffered saline was used to wash cells. The image does not reflect the G quartet structure.

Kotula's et al. research suggests that the aptamer is internalized through a nonstandard mechanism. 5'-dGpdGpdTp dGpdGpdTp dGpdGpdTp dGpdGpdTp dTpdGpdTp dGpdGpdTp dGpdGpdTp dGpdGpdTp dGpdGp-3' 26 8272.41 250800 Kotula J, Sullenger B, et al. 2012. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells. Nucleic Acid and Therapeutics 22.3:187-195. Li, L. et al. 2014. Aptamer photoregulation in vivo. PNAS 11.48: 17099-103.

DNA Protein Affinity (Kd) 0.5 nM PBS and 0.005% tween-20 solution mixture was used as the running buffer, and 50 mM NaOH as the regeneration buffer. 5'-dCpdApdApdTpdTpdGpdGpdGpdCpdCpdCpdGpdTpdCpdCpdGpdTpdApdTpdGpdGpdTpdGpdGpdGpdTp-3' 26 8034.25 242600 Kaur H, Yung L-YL (2012) Probing High Affinity Sequences of DNA Aptamer against VEGF165. PLoS ONE 7(2): e31196. doi:10.1371/journal.pone.0031196

DNA Protein Affinity (Kd) 0.92 nM SPR Buffer A: 10 mM phosphate buffered saline; 138 mM NaCl; 2.7 mM KCL; pH 7.4 with 0.005% Tween 20. Denatured at 80°C for 2 min and slowly cooled to room temperature. dCpdCpdCpdGpdTpdCpdTpdTpdCpdCpdApdGpdApdCpdApdApdGpdApdGpdTpdGpdCpdApdGpdGpdGp 26 7981.22 249100 A Potty et al. Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor. Biopolymers 91(2008):145-155.

DNA Protein Affinity (Kd) 35 nM NaCl (100 mM), MgCl2 (2 mM), KCl (5 mM), CaCl2 (1 mM), Tris-HCl (pH 7.6, 20 mM) heated to 95C for 8 minutes, cool on ice for 10 minutes and left at room temperature for at least 10 minutes. Ka = 1.04 x 10^4 Kd = 0.36 x 10-3 Best KD with lowest Kd. dGpdGpdGpdApdApdCpdGpdCpdApdCpdCpdGpdApdTpdCpdGpdCpdApdGpdGpdTpdTpdTpdCpdCpdCp 26 7957.19 242700 Ruigrok, Vincent J. B., et al. "Kinetic and Stoichiometric Characterisation of Streptavidin-Binding Aptamers." ChemBioChem 13 (2012): 829-836. Print.

DNA Cells LOD 10 CFU/mL A549 PBS solutions or whole blood Room Temperature for 4 hours incubation with ion-selective-electrode (ISE) sensor unspecific reaction and accumulation observed with erythrocyte, platelet and protein molecules Best cell-sensitivity in buffer is -?25.21?mV/log10CA549. 3-aminopropyltriethoxysilane (APTES) and glutaraldehyde (GA) based covalent anchoring method is used to immobilize AS1411 onto the PGO decorated I- -ISE (PGO-I-ISE) 5'-dGpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGpdTpdTpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGp-3' 26 Zhang R, Gu Y, Wang Z, Li Y, Fan Q, Jia Y. Aptamer cell sensor based on porous graphene oxide decorated ion-selective-electrode: Double sensing platform for cell and ion. Biosensors and Bioelectronics. 2018 Jun 15.

DNA Protein Affinity (Kd) 34.25 nM Binding buffer was composed of DPBS supplemented with 5mM MgCl2, 4.5 g/L glucose (Sangon Biotech), and 1 mg/mL BSA and yeast tRNA (0.1mg/mL, Thermo Fisher Scientific). N/A An overview of the physiological factors that adversely affect the in vivo targeting ability of aptamers using Microscale thermophoresis and flow cytometry analysis to investigate the competitive binding between FN1 and NCL AS1411 aptamer’s targeting ability in vivo. In order to maintain the targeting function of the AS1411 aptamer, further physiological modifications were optimized leading to improved tumor-targeting effects between the AS1411aptamer and the FN1 protein. , 5'-dGpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGpdTpdTpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGp-3' 26 8272.3 N/A Jia Liu, Zhiqiang Ren, Yang Sun, Liujun Xu, Dali Wei, Weihong Tan, and Ding Ding ACS Nano 2023 17 (23), 24329-24342 DOI: 10.1021/acsnano.3c10238

DNA Protein Affinity (Kd) 214 ± 26 nM G-quadruplex dTpdTpdApdGpdGpdGpdTpdApdTpdGpdGpdGpdTpdTpdTpdGpdGpdGpdApdTpdApdGpdGpdGpdTpdTp 26 8183.3 g/mole 259800 L/(mole·cm) Ettore Napolitano, Andrea Criscuolo, Claudia Riccardi, Chiara Platella, Rosa Gaglione, Angela Arciello, Domenica Musumeci, Daniela Montesarchio, When annealing is detrimental: The case of HMGB1-targeting G-quadruplex aptamers, International Journal of Biological Macromolecules, Volume 283, Part 1, 2024, 137148, ISSN 0141-8130, https://doi.org/10.1016/j.ijbiomac.2024.137148.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdCpdCpdTpdGpdGpdGpdGpdApdTpdCpdGpdGpdGpdGpdTpdCpdGpdTpdGpdGpdGpdGp-3' 26 8221.3 g/mole 248700 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) 33 µM Column Buffer: 0.5 M LiCl, 20mM Tris-Cl (pH 7.6), 1 mM MgCl₂ Heat to 95°C and then cool to room temperature. 5'-dGpdCpdApdGpdGpdGpdGpdCpdGpdTpdTpdCpdGpdGpdGpdGpdGpdGpdTpdApdCpdCpdGpdCpdTpdGpdCp-3' 27 8414.46 250300 Ellington and Szostak. "Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures." Nature, 355 (1992): 850-852.

DNA Small Organic Affinity (Kd) ~2.5 mM Buffer for CD binding assay: 10 mM sodium phosphate buffer (pH 7.5) and 100 mM NaCl. Heated to 95°C and cooled to 4°C for over 2h. Apparent Kd values for guanidine were the same as arginine and argininamide bound 10-fold more tightly. Forms a G-quartet structure upon binding to arginine. 5'- dGpdApdCpdCpdApdGpdGpdGpdCpdApdApdApdCpdGpdGpdTpdApdGpdGpdGpdApdGpdTpdGpdGpdTpdCp -3' 27 8439.53 273400 K Harada and A Frankel. (1995) Identification of two novel arginine binding DNAs. EMBO J, 14(23): 5798-5811.

DNA Protein Affinity (Kd) 6.0 nM 150 mmol L−1 NaCl, 1 mmol L−1 MgCl2, 5 mmol L−1 KCl and Tris buffer of 20 mmol L−1 (pH 7.4) NA 5'-dApdCpdCpdTpdGpdGpdGpdGpdGpdApdGpdTpdApdTpdTpdGpdCpdGpdGpdApdGpdGpdApdApdGpdGpdTp-3' 27 8459.31 279432 Zhang JQ, Wang YS, Xue JH, He Y, Yang HX, Liang J, Shi LF, Xiao XL. A gold nanoparticles-modified aptamer beacon for urinary adenosine detection based on structure-switching/fluorescence-"turning on" mechanism. J Pharm Biomed Anal. 2012 Nov;70:362-8. doi: 10.1016/j.jpba.2012.05.032. Epub 2012 Jun 1. PMID: 22717140.

DNA Small Organic Affinity (Kd) 86 nM Binding buffer: pH 7.4. 100mM NaCl, 2mM MgCl2, 20mM Tris-HCl, 1 mM CaCl2, 5mM KCl. 25°C in the dark for 2 hours. Singled stranded, truncated. dCpdTpdCpdGpdTpdTpdApdTpdGpdApdCpdTpdApdApdCpdGpdCpdTpdApdGpdCpdCpdCpdGpdGpdGpdGp 27 bases Zheng, X., Jiang, S., Ren, Y., Wang, S., Xie, Y., & Le, T. (2024). High-efficient selection of aptamers by magnetic cross-linking precipitation and development of aptasensor for 1-aminohydantoin detection. LWT - Food Science and Technology, 199. https://doi.org/10.1016/j.lwt.2024.116128

DNA Protein Affinity (Kd) 0.36 µM Incubated in 10 mM Tris−HCl, 10 mM CuSO4, 10 mM sodium erythorbate solution at 37 C for 6 hours. G-quadruplex. Azide modification at 5' end. This is a guide molecule for a nucleolin PROTAC, and is adapted from Nucleolin aptamer AS1411. dTpdGpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGpdTpdTpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGpdTpdGpdGp 27 8576.5 Da 258300 L/(mole·cm) Inducible Degradation of Oncogenic Nucleolin Using an Aptamer-Based PROTAC Miao Chen, Ping Zhou, Yun Kong, Jingrui Li, Yan Li, Yao Zhang, Jie Ran, Jun Zhou, Yan Chen, and Songbo Xie Journal of Medicinal Chemistry 2023 66 (2), 1339-1348 DOI: 10.1021/acs.jmedchem.2c01557

DNA Protein LOD 0.1 fM NEBuffer 2(10X): 50 mM NaCl, 10 mM Tris-HCL, 10 mM MgCl₂ 1 mM dithiothreitol, pH 7.9.

Detection Buffer (total volume): 25 mM HEPES, 20 mM KCL, 200 mM NaCl, 0.05% Triton X-100 and 1% DMSO; pH 7.4) with 0.5 µM hemin.

Consult ref. for procedure. BSA was used as a negative control. Contains a horseradish peroxidase-like DNAzyme with a region complementary to the Lysozyme Aptamer DNA Blocker (highlighted green in the structure). In the presence of the blocker, the two oligonucleotides hybridize, inactivating the DNAzyme. When the target lysozyme is added, DNAzyme-Blocker complex dissociates and the DNAzyme is activated. For more details, consult ref. 5'-dApdGpdGpdGpdApdCpdGpdGpdGpdCpdTpdApdApdGpdTpdApdApdCpdTpdGpdTpdGpdGpdApdGpdGpdGpdTp-3' 28 8798.78 285700 Fu et al. "An ultrasensitive peroxidase DNAzyme-associated aptasensor that utilizes a target-triggered enzymatic signal amplification strategy." Chemical Communications, 47(2011): 9876-9878.

RNA Protein Affinity (Kd) 1.2 nM Binding Buffer 20 mM Tris (pH 7.0), 50 mM NaCl, 5 mM MgCl2,2 mM DTT, and 0.1% Lubrol (without nonspecific RNA) Activity IC50 - 11 nM Binding IC50 - 1.5 nM 5'-rGprGprCprAprGprAprCprCprAprUprAprCprGprGprGprAprGprAprGprAprAprAprCprUprUprGprCprCp-3' 28 9062.59 282300 Tesmer et al., Molecular Mechanism for Inhibition of G Protein-Coupled Receptor Kinase 2 by a Selective RNA Aptamer, Structure (2012), doi:10.1016/j.str.2012.05.002

Peptide Protein Affinity (Kd) 2.4 nM 10mM Hepes-Na-OH, pH 7.4: 135 mM NaCl, 5 mM KCl, 2.5 mM CaCl₂, 0.8 mM MgCl₂, 10 mM glucose, 0.2% BSA, and 0.6 mM NaHCO₃. 4 °C. 5'-PheGlnPheLeuProPheMetPheHisGlnArgValGlnGlnArgLysGluSerLysLysProProAlaLysLeuGlnProArg-3' 28 3922.6 S Ueno et al. In vitro selection of a peptide antagonist of growth hormone secretagogue receptor using cDNA display. PNAS, posted on June 20, 2012, doi: 10.1073/pnas.1203561109 (to appear in print)

DNA Small Organic Affinity (Kd) ~2.5 nM Buffer for CD binding assay: 10 mM sodium phosphate buffer (pH 7.5) and 100 mM NaCl. Heated to 95°C and cooled to 4°C for over 2h. The aptamer's affinity for argininamide and agmatine is 20-fold more than for arginine. Affinities for D-arginine, guanidine, and ethylguanidine are about the same. 5'- dGpdGpdGpdApdTpdCpdGpdApdApdAp dCpdGpdTpdApdGpdCpdGpdCpdCpdTp dTpdCpdGpdApdTpdCpdCpdCp -3' 28 8574.6 264800 K Harada and A Frankel. (1995) Identification of two novel arginine binding DNAs. EMBO J, 14(23): 5798-5811.

DNA Peptide Affinity (Kd) N/A nM Tris buffer (20 mM Tris, 5mM KCL, pH 7.3) In capillary protein capture, this aptamer captured 5 times more insulin than thrombin. Each repeat forms a G-quartet.
5'-dApdCpdApdGpdGpdGpdGpdTpdGpdTpdGpdGpdGpdGpdApdCpdApdGpdGpdGpdGpdTpdGpdTpdGpdGpdGpdGp-3' 28 8911.82 283900 Connor A C, McGown L B, et al. (2006) Insulin Capture by an Insulin-Linked Polymorphic Region G-Quadruplex DNA Oligonucleotide. J Am Chem Soc. 128: 4986-4991.

2'-F-RNA Other Affinity (Kd) . nM 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 80C for 10 min, and cooled down slowly to 4C Binding activity measured by fluorescence intensity within referenced paper UfCpfCpfCpfGpfApUUfApfCpUfGpUfApfCpfApUfApfCpfCpUUfApfGpfCpfCpfCpfApUfApfGpfCpUfGpfGpfCpUfGpfCp 28 9011.31 259100 Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, ƒ??RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Methodƒ? Biol. Pharm. Bull. 37(8) 1411-1415 (2014)

DNA Antibody Affinity (Kd) 10.3 nM Binding buffer was prepared by adding 1 mg/mL BSA and 0.1 mg/mL yeast tRNA into the Dulbecco's PBS (DPBS) containing 0.55 mM MgCl2. NA The CH1S-3 aptamer was modified with biotin on the 5' end. 5'-dGpdTpdCpdCpdApdGpdGpdGpdTpdTpdCpdCpdApdApdGpdGpdTpdGpdCpdTpdTpdCpdGpdTpdGpdGpdApdCp-3' 28 9030 262400 Chen, K.; Zhou, J.; Shao, Z.; Liu, J.; Song, J.; Wang, R.; Li, J.; Tan, W. Aptamers as Versatile Molecular Tools for Antibody Production Monitoring and Quality Control. J. Am. Chem. Soc. 2020 Jun 9; 142(28): 12079-12086. PMID 32516525. DOI: 10.1021/jacs.9b13370.

DNA Protein Affinity (Kd) 33.97 nM 10 mM HEPES-KOH [pH 7.4], 150 mM NaCl Yeast tRNA was introduced in SELEX section as the competitor to DNA candidates. LepDapt-5a was proven to be the most potent aptamer against LipL32 protein. It is a prolific diagnostic agent which can be used in developing potential diagnostic platforms with designing specific hybrid-heterodimeric aptamer to detect pathogenic Leptospira. 5'-dGpdCpdApdGpdCpdApdGpdGpdGpdGpdCpdGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdTpdGpdCpdTpdGpdCp-3' 28 bp 18.48 kDa Yeoh TS, Tang TH, Citartan M. Isolation of a novel DNA aptamer against LipL32 as a potential diagnostic agent for the detection of pathogenic Leptospira. Biotechnol J. 2023 Mar;18(3):e2200418. doi: 10.1002/biot.202200418. Epub 2022 Dec 8. PMID: 36426669.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdTpdCpdApdGpdGpdGpdGpdApdTpdTpdCpdGpdGpdGpdGpdCpdTpdCpdGpdGpdGpdGpdApdGp-3' 28 8847.7 g/mole 274700 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdCpdTpdTpdGpdGpdGpdGpdApdGpdCpdGpdGpdGpdGpdCpdCpdTpdApdGpdGpdGpdGpdApdCp-3' 28 8832.7 g/mole 269900 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdTpdCpdApdGpdGpdGpdGpdTpdCpdCpdGpdGpdGpdGpdCpdGpdTpdGpdGpdGpdGpdCpdApdGp-3' 28 8848.7 g/mole 270900 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) 190 nM Selection Buffer: 0.1 M KCl, 5 mM MgCl₂, 10 mM Na-HEPES (pH 7.4). Kd value listed is for sulforhodamine B immobilized to a column. Free sulforhodamine B binds with Kd= 660 nM. 5'-dCpdCpdGpdGpdCpdCpdApdApdGpdGpdGpdTpdGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdGpdGpdCpdCpdGpdGp -3' 29 9155.94 284400 Wilson C, Szostak J. (1998) Isolation of a fluorophore-specific DNA aptamer with redox activity. Chem Biol. 5(11):609-617.

DNA Protein Affinity (Kd) 0.5 nM 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl₂ Image does not show G quartet formation. The 29mer version has higher affinity than the 15mer version, but less inhibitory activity. 5'-dApdGpdTpdCpdCpdGpdTpdGpdGpdTpdApdGpdGpdGpdCpdApdGpdGpdTpdTpdGpdGpdGpdGpdTpdGpdApdCpdTp-3' 29 9085.94 283600 Tasset, D. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol., 1997(272), 688-698.

DNA Protein Affinity (Kd) 12.21 nM buffer composed of Dulbeccoƒ??s phosphate-buffered saline with calcium and magnesium and 5 mM MgCl2, 0.45% glucose and 100 mg/ml tRNA. 1 hr incubation with cells heated the library for 10 min at 95°C, followed by snap cooling on ice for 10 min Kit-129 has high specificity for c-kit expressing cells based on Flow Cytometry 5'-dGpdCpdTpdCpdApdApdCpdGpdCpdGpdGpdGpdApdCpdGpdGpdCpdTpdCpdTpdCpdCpdCpdApdTpdTpdGpdApdCp-3' 29 8839.75 262400 Development of an Efficient Targeted Cell-SELEX Procedure for DNA Aptamer Reagents Susanne Meyer et al. 2013

DNA Protein Affinity (Kd) 77 nM NaCl (100 mM), MgCl2 (2 mM), KCl (5 mM), CaCl2 (1 mM), Tris-HCl (pH 7.6, 20 mM) Heated to 95C for 8 minutes, cool on ice for 10 minutes and left at room temperature for at least 10 minutes. Ka = 3.98 x 10^4 kd = 3.07 x 10^-3 Best KD with highest Ka. dGpdGpdGpdApdApdTpdCpdGpdCpdCpdApdCpdCpdCpdGpdApdCpdGpdCpdApdGpdGpdGpdTpdTpdTpdCpdCpdCp 29 8864.76 267200 Ruigrok, Vincent J. B., et al. "Kinetic and Stoichiometric Characterisation of Streptavidin-Binding Aptamers." ChemBioChem 13 (2012): 829-836. Print.

RNA Protein Affinity (Kd) 8.53 nM 50 uL Human Serum, 5 mM HEPES n/a n/a dGpdApdTp dGpdTpdGp dGpdGpdTp dGpdTpdAp dGpdTpdTp dGpdGpdAp dGpdGpdGp dTpdApdAp dApdCpdGp dTpdTp 29 9124.01 294200 Byul Nim Oh, Sungeun Lee, Hye-Yeon Park, Jin-Ook Baeg, Moon-Young Yoon, and Jinheung Kim. 2011. Reference: Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties. Analyst, 2011, 136, 3384. DOI: 10.1039/c0an00978d

DNA Protein Affinity (Kd) 1.51 nM 50 uL Human Serum, 5 mM HEPES n/a n/a dCpdApdGp dApdCpdCp dGpdTpdAp dApdGpdGp dGpdApdTp dGpdCpdCp dGpdCpdCp dTpdApdAp dApdCpdAp dCpdCp 29 8865.8 280800 Byul Nim Oh, Sungeun Lee, Hye-Yeon Park, Jin-Ook Baeg, Moon-Young Yoon, and Jinheung Kim. 2011. Reference: Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties. Analyst, 2011, 136, 3384. DOI: 10.1039/c0an00978d

DNA Cells Affinity (Kd) 18.66 nM 50 mM Tris–HCl (pH 7.4), 100 mM NaCl, 5 mM KCl and 1 mM MgCl2. N/A N/A 5'-dCpdTpdCpdCpdCpdApdGpdGpdCpdCpdGpdTpdTpdGpdGpdGpdGpdCpdGpdTpdTpdGpdCpdCpdTpdGpdCpdGpdTp-3' 29 8972.73 Hu, L., Wang, L., Lu, W., Zhai, Q., Fan, D., Liu, X., … Chen, W. (2017). Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve. RSC Advances, 7(19), 11672–11679.

DNA Protein Affinity (Kd) 0.4-0.5 nM This is a truncated sequence cut from 5'-CCTTGGGAYAPYAYGPGYPPGAPPGPYPGGAPGGAGAAGG-3', a SOMAmer. P= NapdU. 5'-dGpdGpdGpdApdTpdApdCpdTpdApdTpdGpdCpdGpdTpdCpdCpdGpdApdCpdCpdGpdCpdTpdCpdGpdGpdApdCpdGp-3' 29 Gelinas, A. D., Tan, T. K., Liu, S., Jaramillo, J. G., Chadwick, J., Harding, A. C., Zhang, C., Ream, B. E., Chase, C. N., Otis, M. R., Lee, T., Schneider, D. J., James, W. S., & Janjic, N. (2023). Broadly neutralizing aptamers to SARS-COV-2: A diverse panel of modified DNA antiviral agents. Molecular Therapy - Nucleic Acids, 31, 370–382. https://doi.org/10.1016/j.omtn.2023.01.008

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdTpdGpdCpdGpdGpdGpdGpdCpdApdApdApdGpdGpdGpdGpdCpdApdApdGpdGpdGpdGpdApdApdCp-3' 29 9188 g/mole 294700 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdTpdCpdTpdGpdGpdGpdGpdApdTpdTpdGpdGpdGpdGpdCpdApdCpdCpdGpdGpdGpdGpdTpdCpdTp-3' 29 9102.9 g/mole 273600 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdApdTpdCpdCpdGpdGpdGpdGpdTpdCpdGpdApdGpdGpdGpdGpdCpdGpdTpdTpdGpdGpdGpdGpdAp-3' 29 9176.9 g/mole 286300 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Protein Affinity (Kd) 80 nM 4% glycerol, 1 mM MgCL₂, 1 mM DTT, 50 mM NaCl, 10 mM Tris-HCl, pH 7.5, r.t. 5'-dTpdCpdGpdApdTpdTpdTpdCpdCpdTpdTpdApdGpdTpdTpdGpdTpdCpdTpdTpdCpdCpdTpdTp dApdGpdTpdGpdApdGp-3' 30 9160.02 274800 A Lakamp and M Ouellette. A ssDNA aptamer that blocks the function of the anti-FLAG M2 antibody. J. Nucleic Acids 2011: doi:10.4061/2011/720798

DNA Protein Affinity (Kd) 80 nM 50 mM Tris-HCl, pH 8, 1mM DTT, 80 mM KCl, 6 mM MgCl₂ for ten minutes. 5'-dApdGpdGpdApdApdGpdGpdCpdTpdTp dTpdApdGpdGpdTpdCpdTpdGpdApdGp dApdTpdCpdTpdCpdGpdGpdApdApdTp-3' 30 9326.14 300100 Y-T Lai and J DeStefano. DNA aptamers to human immunodeficiency virus reverse transcriptase selected by a primer-free SELEX method: characterization and comparison with other aptamers. Nucleic Acid Therapeutics 22(2012): 162-176.

2'-F-RNA Other Affinity (Kd) . nM 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 80C for 10 min, and cooled down slowly to 4C fCpfApfCpfCpfApfCpfGpfApUfCpfApfCpfGpfGpUUUfCpfCpfCpUfCpfGpfCpfApfGpfGpUfApfApfGpfGpUfGpUfApfGpfAp 30 9769.72 292400 Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, ƒ??RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Methodƒ? Biol. Pharm. Bull. 37(8) 1411-1415 (2014)

DNA Protein Affinity (Kd) n/a nM Cell Culture Medium: 50% DMEM, 50% Hamƒ??s F-12 Cell culture medium supplemented with: 50 mg/ml ascorbic acid, 250 ng/ml amphotericin B, 5mg/ml insulin (bovine pancreas), 0.4 ng/ml hydrocortisone and 10% heat-inactivated fetal bovine serum. 5'-dApdCpdTpdTpdTpdTpdGpdApdApdTpdGpdTpdGpdGpdCpdApdApdCpdApdApdApdTpdTpdCpdGpdApdCpdApdGpdGp-3' 30 9254.11 298000 Simmons SC, Jamsa H, Silva D, Cortez CM, McKenzie EA, et al. (2014) Anti-Heparanase Aptamers as Potential Diagnostic and Therapeutic Agents for Oral Cancer. PLoS ONE 9(10): e96846. doi:10.1371/journal.pone.0096846

DNA Protein Affinity (Kd) n/a nM 50 mM Tris-HCl, 10 mM KCl, 100 mM NaCl Specificity tested against Streptavidin, Avidin, and BSA. FAM-Labeled at 3' end. 5'-dGpdGpdTpdGpdGpdTpdGpdGpdGpdGpdGpdGpdGpdGpdTpdTpdGpdGpdTpdApdGpdGpdGpdTpdGpdTpdCpdTpdTpdCp-3' 30 9493.19 288200 Pu, Y.; Zhu, Z.; Han, D.; Liu, H.; Liu, J.; Liao, J.; Zhang, K.; & Tan, W. Insulin-Binding Aptamer-Conjugated Graphene Oxide for Insulin Detection. Analyst, 2011, 136, 4138-4140

DNA Protein Affinity (Kd) 6.2 nM 40 mM HEPES, pH7.5, 125 mM NaCl, 5 mM KCl, 1 mM MgCl2, 0.01% Tween 20 NA 5'-dCpdtpdApdGpdtpdtpdCpdtpdGpdCpdCpdtpdtpdApdApdtpdApdtpdGpdGpdtpdCpdGpdGpdtpdtpdApdApdGpdCp-3' 30 9203 283200 Minagawa H, Kataoka Y, Fujita H, Kuwahara M, Horii K, Shiratori I, Waga I. Modified DNA Aptamers for C-Reactive Protein and Lactate Dehydrogenase-5 with Sub-Nanomolar Affinities. International Journal of Molecular Sciences. 2020; 21(8):2683. https://doi.org/10.3390/ijms21082683

DNA Small Organic Affinity (Kd) 5.5 nM pH 7.5 buffer (20 mM HEPES, 1 M NaCl, 10 mM MgCl2, and 5 mM KCl) NA 5'-dGpdGpdApdApdTpdCpdGpdTpdGpdGpdGpdTpdGpdGpdTpdApdGpdGpdGpdTpdApdGpdGpdGpdGpdApdTpdGpdCpdAp-3' 30 9488.22 308100 Park, J., Yang, K.-A., Choi, Y., & Choe, J. K. (2022). Novel ssdna aptamer-based fluorescence sensor for perfluorooctanoic acid detection in water. Environment International, 158, 107000. https://doi.org/10.1016/j.envint.2021.107000

DNA Protein Affinity (Kd) 50.9 nM In the presence of different concentrations of aptamers (0–1500 nm), human a-thrombin (2.5 NIH units per mL; CellSystems) and UFH (0.01 UmL1; LiqueminO, Roche) were incubated in assay buffer (1 3 PBS, pH 7.4, 3 mm MgCl2, 1 mg/mL1 BSA) for 5 min at room temperature in a total volume of 100 mL. After incubation, a mixture (100 mL) of the fluorogenic peptide-substrate Z-Gly-Gly-Arg-AMC (100 mm; Bachem, Weil am Rhein, Germany) and AT (0.032 UmL1; KyberninO, CSL Behring, Hattersheim am Main, Germany) in assay buffer was added, and the kinetics of thrombin-mediated substrate hydrolysis were monitored at 37 C by using an Ascent Fluoroscan plate reader (Thermo Fisher Scientific, Langenselbold, Germany). Each experiment was performed in duplicate. NA 5'-dGpdGpdTpdTpdGpdGpdTpdGpdTpdGpdGpdTpdTpdGpdGpdApdApdApdApdApdApdApdApdApdApdApdApdApdApdAp-3' 30 9424.2 325000 Müller, J., Wulffen, B., Pötzsch, B., & Mayer, G. (2007). Multidomain Targeting Generates a High-Affinity Thrombin-Inhibiting Bivalent Aptamer. ChemBioChem, 8(18), 2223–2226. doi:10.1002/cbic.200700535

DNA Small Organic Affinity (Kd) 1.64 ± 0.181 µM In SELEX Buffer (see Refolding Protocol) at 25°C with shaking at 200 rpm. Hybridized in SELEX buffer (20 mM NaCl, 10 mM MgCl2, 6mM KCl, 5 mM CaCl2, 4% DMSO, and 40 mM Tris-HCL at pH 7.5) for 5 minutes at 95°C, cooled to 25°C for 10 minutes and left overnight at 4°C. dTpdTpdCpdTpdGpdApdApdTpdTpdApdApdApdGpdApdGpdApdApdTpdApdApdApdTpdGpdApdApdTpdTpdGpdApdAp 30 9309.2 g/mole 321900 L/(mole·cm) Enhanced Detection of Enrofloxacin in Seawater Using a Newly Selected Aptamer on a Graphite Oxide-Based Biosensor Sin Yu Lam, Pan Li, Linjie Jin, Hau Yi Chan, Yuefei Ruan, Chun Kit Kwok, and Pik Kwan Lo Analytical Chemistry 2025 97 (12), 6735-6744 DOI: 10.1021/acs.analchem.4c07052

DNA Cells Affinity (Kd) nM Nude mouse bearing PC3 PBs was chosen to perform aptamer SELEX by a library composed of different ssDNA sequences. When the tumor models were ready about 4–6 weeks after inoculation (nude mouse at the middle stage of PC3 PB development before body paralysis), 10 μg thioaptamer library was intravenously injected to mice. After 4 hours circulation, mice were sacrificed, and bone marrow was collected and frozen in liquid nitrogen. Tissues were homogenized, and DNA was extracted for PCR amplification with aptamer library-specific primers. PCR products were filtered by a Millipore YM-30 filter to purify dsDNA product. The product was incubated with streptavidin-coated magnetic beads in buffer (10 mM Tris–HCl, 2 M NaCl, and 1 mM EDTA [pH 7.5]) for 20 minutes. Biotin on the reverse strand of the dsDNA binds to the streptavidin beads, followed by separation of the two DNA strands in melting solution (0.1 M NaOH). The forward strands were collected after filter with Millipore YM-10 filter for the next round of selection. dCpdTpdCpdTpdApdTpdTpdGpdApdTpdGpdCpdCpdTpdGpdCpdCpdTpdGpdCpdGpdTpdGpdCpdGpdTpdGpdCpdTpdTpdGpdTpdApdGp 30 9211 g/mole 269900 L/(mole·cm) Chen L, He W, Jiang H, Wu L, Xiong W, Li B, Zhou Z, Qian Y. In vivo SELEX of bone targeting aptamer in prostate cancer bone metastasis model. Int J Nanomedicine. 2018 Dec 21;14:149-159. doi: 10.2147/IJN.S188003. PMID: 30613143; PMCID: PMC6306056.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdApdApdTpdGpdGpdGpdGpdApdCpdTpdApdGpdGpdGpdGpdTpdTpdCpdGpdGpdGpdGpdApdCpdGpdAp-3' 30 9498.2 g/mole 306200 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dApdCpdCpdTpdApdGpdGpdGpdGpdTpdApdCpdGpdGpdGpdGpdCpdCpdApdGpdGpdGpdGpdCpdCpdTpdGpdGpdGpdGp-3' 30 9395.1 g/mole 289400 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdApdApdCpdGpdGpdGpdGpdCpdTpdApdApdGpdGpdGpdGpdCpdApdGpdApdGpdGpdGpdGpdCpdCpdTp-3' 30 9468.1 g/mole 298900 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

RNA Small Organic Affinity (Kd) 10 µM Binding Buffer (20 mM Tris-HCl (pH 7.5 at 23 °C), 450 mM NaCl, 100 mM KCl, 10 mM MgCl₂, 1 mM MnCl₂, and 5 mM CaCl₂) 5'-{5'/Phosphate}-rGprGprAprAprGprAprGprAprUprGprGprCprGprAprCprUprAprAprAprAprCprGprAprCprUprUprGprUprCprGprCp-3' 31 10044.17 316000 Kozumi and Breaker. "Molecular Recognition of cAMP by an RNA Aptamer." Biochemistry, 39 (2000): 8983-8992.

DNA Protein Affinity (Kd) N/A nM Buffer for Clotting Inhibition assay: Tris-HCl pH 8.0, 5 mM KCl, 100 mM NaCl. Aptamer consists of a stem-loop (see figure) with the loop forming a G-quartet identical to the 15-mer thrombin-binding aptamer in the Related Aptamers section below. The authors optimized the stem for clotting inhibition. 5'-dApdGpdCpdGpdAp dGpdTpdApdGpdGpdTpdTpdGpdGpdTpdGpdTpdGpdGpdTpdTpdGpdGpdGpdGpdCp dTpdCpdGpdCpdTp-3' 31 9710.34 295700 K Ikebukuro et al. Analysis of the evolution of the thrombin-inhibiting DNA aptamers using a genetic algorithm. Biotechnol Lett (2006) 28:1933ƒ??1937.

RNA Protein Affinity (Kd) 7.4 nM 1X PBS, 5 mM MgCl2 rGprGprCprGprAprAprUprUprCprAprGprGprGprGprAprCprGprUprAprGprCprAprAprUprGprAprCprUprGprCprCp 31 8089.29 261800 (1) Bogomolova, A., Aldissi, M. ƒ??Real-time and label-free analyte detection in a flow-through mode using immobilized fluorescent aptamer/quantum dots molecular switches.ƒ? Biosensors and Bioelecgtronics, 66 (2015): 290-296. (2) Hesselberth, J., et al. ƒ??In vitro Selection of RNA Molecules That Inhibit the Activity of Ricin A-chain.ƒ? Journal of Biological Chemistry, 275, 7 (2000): 4937-4942.

DNA Protein Affinity (Kd) Not given nM 1X PBS or a buffer of [20 mM Tris-HCl (pH 7.2), 140 mM NaCl, 5 mM KCl]. The aptamer can form a G-quadruplex in the presence of K+ ions. 5'-dGpdGpdTpdGpdGpdCpdApdGpdGpdApdGpdGpdApdCpdTpdApdTpdTpdTpdApdTpdTpdTpdGpdCpdTpdTpdTpdTpdCpdTp-3' 31 "A flexible multiplexed immunosensor for point-of-care in situ wound monitoring", Yuji Gao, et. al. (2021) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8139589/pdf/abg9614.pdf

DNA Cells Affinity (Kd) 101.76+/-9.11 nM This work incubated 10^5 CFU (colony forming units) and the library in 20 mm Tris HCl, 5 mM KCl, 100 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 0.02% Tween-20 for 1 hour at 37°C according to reference 21 (see below) of this entry's literature. Kim, H. R.; Song, M. Y.; Kim, B. C. Rapid isolation of bacteria specific aptamers with a non-SELEX-based method. Anal. Biochem. 2020, 591, No. 113542. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4841571/ Molecular weight and specificity were not provided in this work or in its references. 5'-dTpdCpdApdApdGpdGpdTpdCpdGpdCpdApdApdTpdTpdTpdCpdGpdApdGpdCpdApdGpdApdApdCpdTpdTpdApdApdGpdAp-3' 31 Mengyue Liu, Lingjun Geng, Fengjuan Zhang, Shouyi Dou, Falan Li, Zhanli Liu, Yemin Guo, and Xia Sun Journal of Agricultural and Food Chemistry 2022 70 (50), 15990-15998 DOI: 10.1021/acs.jafc.2c06167 https://pubs.acs.org/doi/abs/10.1021/acs.jafc.2c06167?ref=PDF

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdApdCpdCpdCpdGpdGpdGpdGpdApdGpdApdApdGpdGpdGpdGpdCpdCpdApdTpdGpdGpdGpdGpdTpdTpdCp-3' 31 9748.3 g/mole 304700 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

RNA Small Organic Affinity (Kd) 3.3 nM Binding Buffer (20 mM Trisƒ??HCl (pH 7.5), 0.3 M NaCl and 5 mM MgCl2) 5'-rGprGprCprAprCprGprUprGprUprAprUprUprAprCprCprCprUprAprGprUprGprGprUprCprGprAprCprGprUprGprCprCp-3' 32 10232.17 307700 Kiga, D., et al. "An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition." Nucleic Acids Research, 26 (1998): 1755-1760.

RNA Small Organic Affinity (Kd) 200 µM Selection Buffer (10 mM HEPES (pH 7.0), 300 mM NaCl, and 7.5 mM MgCl2 (buffer B) and 0.1 mM each of ZnCl2, CaCl2, and MnCl2 and 0.01 mM CuCl) Reaction Buffer (50 mM sodium borate (pH 8.0), 42 mM KCl, 7.5 mM MgCl2, and 0.4 mM ZnCl2) 5'-P-rGprGprUprCprUprUprAprCprGprUprCprGprUprUprCprGprCprGprAprCprUprAprUprUprGprGprGprAprGprAprCprCp-3' 32 10233.16 310800 Majerfeld and Yarus. "Isoleucine:RNA sites with associated coding sequence." RNA, 4 (1998): 471-478.

Chimeric Protein Affinity (Kd) 140 pM Selection Buffer (PBS: 10.1 mM Na₂HPO₄, 1.8 mM KH₂PO4, 137 mM NaCl and 2.7 mM KCl (pH 7.4)) with 0.01 % human serum albumin Heated at 90°C for 2 min and then cooled on ice. Binding with Reduced VPF/VEGF, platelet-derived growth factor AB, basic fibroblast growth factor, antithrombin III, and thrombin was measured. Aptamer bound with >650- fold preference to target. The sequence is denoted with d=deoxy, r=ribo, n=2'-NH2, m=2'-O-Me, s=phosphorothioate, and p=phosphate
Structure shown omits 5'- and 3'-terminal phosphorothioate thymine linkers. 5'-dTsdTsdTsdTsmApnCpnCpnCpnUprGprApnUpmGprGpnUpmApmGprApnCpmGpnCpnCpmGpmGpmGpmGpnUpmGpdTsdTsdTsdTs-3' 32 16446.5 300400 Green L, Jellinek D, Janjic N, et al. (1995) "Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial growth factor." Chem Biol. 2:683-695.

DNA Protein Affinity (Kd) <100 nM 10 mM Tris/HCl, 150 mM NaCl, 5 mM KCl, 5 mM MgCl₂, 0.05% Tween 20, pH 7.4, r.t. The DNA library was heated at 95 °C for 10 min and then gradually cooled to 25 °C over a period of 30 min in TBS buffer (10mM Tris/HCl, 150mM NaCl, 5mM KCl, 5mM MgCl2, pH 7.4). Binding was not detectable during the course of internal investigation. Gel-Shift and Forte-Bio Octet methods to attempt to determine Kd did not generate results indicative of aptamer-target binding. 5'-dTpdTpdTpdTpdTpdApdApdTpdTpdApdApdApdGpdCpdTpdCpdGpdCpdCpdApdTpdCpdApdApdApdTpdApdGpdCpdTpdTpdTp-3' 32 9747.45 305200 N Savory et al. Selection of DNA aptamer against prostate specific antigen using a genetic algorithm and application to sensing. Biosens. Bioelectron. 26 (2010): 1386-1391.

DNA Small Organic Affinity (Kd) 2.27 nM Optimized Buffer: 10 mM Na₂HPO₄, 2 mM KH₂, 500 mM NaCl, pH 7.4. Competition binding assay performed by Mei et al. showed that the aptamer requires the entire p-nosyl-amide moiety. Forms an anti-parallel G-quadruplex. 5'- dApdTpdCpdApdTpdGpdGpdTpdGpdGp dGpdTpdApdTpdCpdGpdGpdCpdApdCp dTpdCpdGpdTpdTpdGpdGpdTpdTpdGp dApdTp-3' 32 9917.5 306300 Mei H et al. (2012) Functional-group specific aptamers indirectly recognizing compounds with alkyl amino group. Anal. Chem. 84: 7323 - 7329

DNA Small Organic Affinity (Kd) 12.7-16.9 nM Column Buffer: 300 mM NaC1, 5 mM MgC12, 20 mM Tris (pH 7.6) Heated to 75°C for 5 min and then cooled to room temperature for 20-30 min. This aptamer has high specificity to adenosine and low specificity to ATP, AMP, Guanosine, Cytidine, Uridine and Theophylline 5'-dGpdTpdApdTpdTpdGpdCpdGpdGpdApdGpdGpdApdApdGpdGpdTpdTpdTpdTpdTpdApdApdCpdCpdTpdTpdCpdGpdGpdGpdGp-3' 32 9966.5 311000 Li, Y., Liu, B., Huang, Z., & Liu, J. (2020). Engineering base-excised aptamers for highly specific recognition of adenosine. Chemical Science. doi:10.1039/d0sc00086h

DNA Small Organic Affinity (Kd) 987.9 nM 50mM sodium acetate, 1% (w/v) BSA, 0.05% (v/v) Tween 20, 1mM MgCl2 (Sigma, all components) adjusted to pH 5.5 ViennaRNA 5'-dGpdTpdGpdGpdApdGpdGpdCpdGpdGpdTpdGpdGpdCpdCpdApdGpdTpdCpdTpdCpdGpdCpdGpdGpdTpdGpdGpdCpdGpdGpdCp-3' 32 9995.4 296700 Chiu, A.S., Sankarapani, V., Drabek, R., Jackson, G.W., Batchelor, R.H. and Kim, Y., 2018. Inhibition of vitamin C oxidation by DNA aptamers. Aptamers, 2, pp.1-20.

DNA Protein Affinity (Kd) N/A nM Sodium Phosphate Buffer: 10 mM NaH2PO4/Na2HPO4, 90 mM NaCl, pH 7.0 PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM NaH2PO4/Na2HPO4, 1.8 mM KH2PO4/K2HPO4, pH = 7.3 N/A This DNA sequence forms a G quadruplex. 5'-dGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdApdGpdGpdGpdAp-3' 32 11724.57 Riccardi C, D’Aria F, Digilio FA, Carillo MR, Amato J, Fasano D, De Rosa L, Paladino S, Melone MAB, Montesarchio D, Giancola C. Fighting the Huntington’s Disease with a G-Quadruplex-Forming Aptamer Specifically Binding to Mutant Huntingtin Protein: Biophysical Characterization, In Vitro and In Vivo Studies. International Journal of Molecular Sciences. 2022; 23(9):4804. https://doi.org/10.3390/ijms23094804

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dGpdGpdGpdGpdCpdCpdApdTpdGpdGpdGpdGpdApdGpdTpdCpdGpdGpdGpdGpdTpdCpdGpdTpdGpdGpdGpdGpdTpdGpdApdCp-3' 32 10099.5 g/mole 311100 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dTpdCpdCpdGpdGpdGpdGpdApdCpdGpdGpdGpdGpdApdCpdGpdGpdGpdGpdCpdCpdCpdCpdGpdGpdGpdGpdApdGpdTpdCpdCp-3' 32 9974.4 g/mole 300200 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

DNA Small Organic Affinity (Kd) nM G-quadruplex–forming oligonucleotides were prepared at a final concentration of 7.5 μM in 25 mM Tris–HCl buffer (pH 7.0) containing varying NaCl concentrations. The mixtures were statically incubated to promote proper folding. Crystal violet (CV) was then added to a final concentration of 15 μM, and the mixtures were incubated at 30 °C for 1 h. 10-min heat treatment at 95 °C 5'-dApdCpdCpdGpdGpdGpdGpdCpdApdGpdGpdGpdGpdCpdCpdGpdGpdGpdGpdCpdGpdApdTpdGpdGpdGpdGpdApdTpdGpdCpdAp-3' 32 10062.5 g/mole 313000 L/(mole·cm) Nahid Davoudi, Mandana Behbahani, Hassan Mohabatkar, Ghasem Dini, Mehran Bakhshesh. A novel G-quadruplex aptamer with high affinity for the specific detection of equine herpesvirus type 1: Comprehensive biophysical and analytical characterization, Talanta, Volume 297, Part B. 2026. 128713. ISSN 0039-9140. https://doi.org/10.1016/j.talanta.2025.128713.

RNA Protein Affinity (Kd) 6.9 nM Binding Buffer (50 mM Tris-HC1 (pH 7.7), 200 mM potassium acetate, and 10 mM DTT) 5'-rUprUprAprCprCprAprCprGprCprGprCprUprCprUprUprAprAprCprUprGprCprUprAprGprCprGprCprCprAprUprGprGprCp-3' 33 10441.29 302800 Chen and Gold. "Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity." Journal of Biochemistry, 33(1994): 8746-8756.

DNA Protein Affinity (Kd) 3.5 nM Krebs-Ringer HEPES Buffer. Tested in vivo. 95 C for 5 minutes, allowed to cool to room temperature. The 'N's in the structure indicate 5-[N-(1-naphthylmethyl)carboxamide]-2-deoxyuridine (Nap-dU) used in place of Thymine to improve binding efficiency. 5'-dCpdGpdCpdCpdTpdGpdGpdNpdGpdNpdNpdApdApdGpdApdCpdApdApdCpdCpdNpdCpdNpdApdGpdGpdNpdCpdApdGpdGpdCpdGp-3' 33 10129.43 313200 Yunn N, Koh A, Han S, Lim JH, Park S, et al. (2015) Agonistic Aptamer to the Insulin Receptor Leads to Biased Signaling and Functional Selectivity Through Allosteric Modulation. Nucleic Acids Research 1. doi:10.1093/narlgkv767

2'-F-RNA Other Affinity (Kd) 0.8 nM For Binding Assays on Exosomes: 200 nM of aptamer in 1X PBS PBS buffer used to wash For Binding Assays on Cells: 200 nM of aptamer in serum-free medium Serum-free medium used to wash N/A Specific for breast cancer exosomes. Able to discriminate from two other cancer exosome types. Does not react with HSA 5'-fUprGpfUprGprGpfCprAprGpfUpfUprAprAprGprAprApfUprAprGprApfUpfCpfUpfUpfCprGpfCpfUprGpfCprGprApfUpfUp-3' 33 10.652 333200 Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163.

DNA Cells Affinity (Kd) 110-85.6 nM PBS with 1mM MgCl2, 0.1 mg/mL tRNA, 1mg/mL bovine serum albumin, and 10% FCS Mfold BIFUNCTIONAL aptamer. Affinity value is not a range. First value is affinity with bEnd.3, second value is affinity with MDA 5'-dGpdCpdGpdCpdGpdGpdTpdApdCpdCpdGpdCpdGpdCpdTpdApdApdCpdGpdGpdApdGpdGpdTpdTpdGpdCpdGpdTpdCpdCpdGpdTp-3' 33 10266.58 304900 Macdonald, J., Denoyer, D., Henri, J., Jamieson, A., Burvenich, I. J., Pouliot, N., & Shigdar, S. (2020). Bifunctional aptamer–doxorubicin conjugate crosses the blood–brain barrier and selectively delivers its payload to EpCAM-positive tumor cells. Nucleic acid therapeutics, 30(2), 117-128.

DNA Small Organic Affinity (Kd) Tfr: 110 ± 22.0, EpCAM: 85.6 ± 28.5 nM 0.1 M sodium acetate (CH3COONa), 0.05 M sodium chloride (NaCl), and 5 mM MgCl2 Bifunctional aptamer 5'-dGpdCpdGpdCpdGpdGpdTpdApdCpdCpdGpdCpdGpdCpdTpdApdApdCpdGpdGpdApdGpdGpdTpdTpdGpdCpdGpdTpdCpdCpdGpdTp-3' 33 Macdonald, J., Denoyer, D., Henri, J., Jamieson, A., Burvenich, I. J. G., Pouliot, N., and S. Shigar. 2020. Bifunctional Aptamer–Doxorubicin Conjugate Crosses the Blood–Brain Barrier and Selectively Delivers Its Payload to EpCAM-Positive Tumor Cells. Nucleic Acid Therapeutics 30:2: 117-128. DOI: 10.1089/nat.2019.0807

DNA Protein Affinity (Kd) 50.62 ± 0.038 nM Binding buffer solution, 4 μM target, and 5 μM aptamer; incubated (2 hours) 5'-dGpdGpdCpdApdApdCpdGpdGpdTpdCpdTpdTpdTpdGpdCpdTpdApdTpdTpdTpdApdCpdGpdGpdCpdApdApdCpdApdCpdCpdGpdCp-3' 33 10,890 Duan M, Ren K, Chen X, Chang Y, Lv Z, Wang Z, Wu S, & Duan N. (2024). "Discovery and design of an aptamer that inhibits Shiga toxin type 2 activity by blocking Stx 2 B subunit-Gb3 interaction." International Journal of Biological Macromolecules, (277)134365. https://doi.org/10.1016/j.ijbiomac.2024.134365

DNA Protein Affinity (Kd) ~28 nM Selection Buffer (SHMCK; 20 mM HEPES (pH 7.35), 120 mM NaCl, 5 mM KCl, 1 mM CaCl₂, 1 mM MgCl₂).
Denature at 94°C for 5 minutes, cool slowly to room temperature. 5'-dApdTpdCp dCpdTpdGp dTpdGpdAp dGpdGpdAp dApdTpdGp dCpdTpdCp dApdTpdGp dCpdApdTp dApdGpdCp dApdApdGp dGpdGpdCp dTp-3' 34 10506.89 331300 Tang, J., et al. "In vitro selection of DNA aptamer against abrin toxin and aptamer-based abrin direct detection." Biosensors and Bioelectronics, 22 (2007): 2456-2463.

RNA Protein Affinity (Kd) 190 pM Selection Buffer (1X PBS = 10.1 mM Na2HPO4/1.8 mMKH2PO4/137 mM NaCl/2.7 mM KCl, pH 7.4) Heat-denatured bFGF (90C for 15 min) binds to aptamer with Kd > 1uM. This is a biphasic binding with Kd 0.19+-0.02 nM. 5'-rGprGprUprGprAprAprGprGprCprAprAprCprGprUprAprUprAprGprGprCprAprAprGprCprAprCprAprCprUprUprCprAprCprCp-3' 34 10943.71 340500 Jellinek, D., et al. "High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding." Proceedings of the National Academy of Sciences of the United States of America, 90(1993): 11227ƒ??11231.

2'-F-RNA Protein Affinity (Kd) 3.49 nM Binding buffer: 20 mM HEPES (pH 7.0), 150 mM NaCl, 1 mM MgCl₂, 2 mM DTT, and 40 U RNase Inhibitor MDA-MB-453 breast cancer cell line, T47D breast cancer cells, and KPL-4 breast cancer cells (allErbB2 positive)showed staining, while ErbB2 negative cell line MCF-7 did not. 5'-rAprGpfCpfCprGpfCprGprAprGprGprGprGprAprGprGprGprApfUprAprGprGprGpfUprAprGprGprGpfCprGpfCprGprGpfCpfUp-3' 34 11239.85 341100 Kim and Jeong. "In Vitro Selection of RNA Aptamer and Specific Targeting of ErbB2 in Breast Cancer Cells." Oligonucleotides, doi:10.1089/oli.2011.028.

DNA Protein Affinity (Kd) N/A nM SHCMK binding buffer: 20 mM HEPES, pH 7.35, 120 mM KCL, 1 mM CaCl₂, and 1 mM MgCl₂ Was used in a sandwich assay with M64CA. 5'- dTpdTpdCpdGpdGpdGpdApdApdTpdGp dApdTpdTpdApdTpdCpdApdApdApdTp dTpdTpdApdTpdGpdCpdCpdCpdTpdCp dTpdGpdApdTp-3' 34 10421.87 326100 Qin, L., et al.(2009). "The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis." Clin Chem Lab Med, 47(4), 405-411. doi: 10.1515/CCLM.2009.097

RNA Protein Affinity (Kd) 12 nM Dulbecco's Modified Eagle's Medium (DMEM), 10% FBS, 2mM L-glutamine 85C for 5 minutes, snap cooled on ice for 2 minutes, and then warmed up to 37C. Note that the sequence is 2'-fluoropyrimidine, 2'-ribopurine (see reference paper). 5'-rApfUprGprApfUpfCprAprApfUpfCprGpfCpfCpfUpfCprAprApfUpfUpfCprGprApfCprAprGprGprAprGprGpfCpfUpfCprApfCp-3' 34 10875.53 335000 Laura Cerchia, Carla L Esposito, Simona Camorani, Anna Rienzo, Loredana Stasio, Luigi Insabato, Andrea Affuso and Vittorio de Franciscis,"Targeting Axl With an High-affinity Inhibitory Aptamer". Molecular Therapy vol.20 no.12, 2291-2303, Dec2012.

DNA Small Organic Affinity (Kd) 0.92-0.98 nM Cyanuric acid, Ammeline, Ammelide. NA Truncated from aptamer Rd29C33. 5'- dGpdCpdAp dCpdApdCp dCpdGpdAp dTpdGpdGp dCpdGpdGp dTpdCpdCp dTpdGpdTp dTpdTpdAp dGpdGpdGp dGpdGpdTp dGpdTpdGp dCp -3' 34 10546.8 317300 Gu, Chunmei et al. “Label-free fluorescence detection of melamine with a truncated aptamer.” The Analyst vol. 141,14 (2016): 4511-7. doi:10.1039/c6an00537c

DNA Protein Affinity (Kd) 3 nM The aptamer was dissolved in 10 mM HEPES buffer (pH 7.4 with 150 mM NaCl). This buffer was also employed in all IFN-γ sensor experiments. Many uses of this aptamer in the literature use an amino modifier on the 5' end and a thiol modification on the 3' end. 5'-dGpdGpdGpdGpdTpdTpdGpdGpdTpdTpdGpdTpdGpdTpdTpdGpdGpdGpdTpdGpdTpdTpdGpdTpdGpdTpdCpdCpdApdApdCpdCpdCpdCp-3' 34 Development of an aptamer beacon for detection of interferon-gamma. Tuleuova, et. al (2010) https://pubmed.ncbi.nlm.nih.gov/20121141/

RNA Protein Affinity (Kd) 12 nM filter binding analysis with the soluble extracellular domain of human Axl, Dtk, and Mer as targets (R&D Systems, Minneapolis, MN), was performed by incubating 1 nmol/l of radiolabeled aptamers with 1, 3.2, 10, 32, 100, 320, and 1,000 nmol/l of EC-Axl, EC-Dtk, or EC-Mer rAprUprGprAprUprCprAprAprUprCprGprCprCprUprCprAprAprUprUprCprGprAprCprAprGprGprAprGprGprCprUprCprAprCp 34 10297.6 g/mole 319300 L/(mole·cm) Cerchia L, Esposito CL, Camorani S, Rienzo A, Stasio L, Insabato L, Affuso A, de Franciscis V. Targeting Axl with an high-affinity inhibitory aptamer. Mol Ther. 2012 Dec;20(12):2291-303. doi: 10.1038/mt.2012.163. Epub 2012 Aug 21. PMID: 22910292; PMCID: PMC3519989.

RNA Protein Affinity (Kd) 12 nM Purified RNA was folded by heating to 82 °C 5′ in selection buffer (150 mmol/l NaCl, 20 mmol/l KCl, 20 mmol/l HEPES) and cooling slowly to room temperature rCprUprGprUprAprAprUprUprGprGprCprGprUprAprUprGprUprAprUprGprUprAprAprCprCprCprAprGprGprCprAprCprCprAprAprAprCprAprCprCprCprCprUprUprAprUprUprGprUprGprGprCprAprCprCp 34 10823.6 g/mole 329400 L/(mole·cm) Berezhnoy A, Stewart CA, Mcnamara JO 2nd, Thiel W, Giangrande P, Trinchieri G, Gilboa E. Isolation and optimization of murine IL-10 receptor blocking oligonucleotide aptamers using high-throughput sequencing. Mol Ther. 2012 Jun;20(6):1242-50. doi: 10.1038/mt.2012.18. Epub 2012 Mar 20. PMID: 22434135; PMCID: PMC3369303.

DNA Protein Affinity (Kd) 1.37 (reported value) nM Binding Buffer: 50 mM phosphate, 150 mM NaCl, pH 7.8 Heated at 95°C for 5 min, Cooled to room temperature for 30 min before binding studies Binds specifically to IL-23 (P19 subunit) and does not cross-react with the P40 subunit or unrelated proteins Selected using protein-SELEX Potential for therapeutic and diagnostic applications Featured Secondary Structure is from IT Oligo Analyzer Tool 5'-dGpdGpdTpdGpdGpdTpdApdGpdTpdTpdGpdGpdGpdApdGpdGpdGpdTpdApdGpdGpdGpdTpdGpdGpdTpdGpdGpdTpdApdGpdTpdTpdGp-3' 34 10817 g/mole 344400 L/(mole·cm) Rezaee, M. A., Shobeiri, S. S., Moghadam, M., Mashayekhi, K., & Sankian, M. (2024). In vitro identification of single-stranded DNA aptamers targeting human IL-23 using the protein-SELEX strategy. Journal of pharmaceutical and biomedical analysis, 247, 116245. https://doi.org/10.1016/j.jpba.2024.116245

RNA Small Organic Affinity (Kd) 88 nM Column Buffers (1 M LiC1, 5 mM MgC12, and 25 mM HEPES (pH 7.4) or 1 M NaCl, 5 mM MgC12, and 25 mM HEPES (pH 7.4)) 5'-rCprCprGprGprUprGprCprGprCprAprUprAprAprCprCprAprCprCprUprCprAprGprUprGprCprGprAprGprCprAprAprGprGprAprAp-3' 35 11263.9 341600 Lorsch and Szostak. "In vitro selection of RNA aptamers specific for cyanocobalamin." Biochemistry, 33 (1994): 973-982.

DNA Protein Affinity (Kd) N/A nM SHCMK binding buffer: 20 mM HEPES, pH 7.35, 120 mM KCL, 1 mM CaCl₂, and 1 mM MgCl₂ Was used in a sandwich assay with M64CA. 5'- dTpdGpdGpdGpdApdGpdCpdTpdGpdAp dTpdGpdTpdCpdGpdCpdApdTpdGpdGp dGpdTpdTpdTpdTpdGpdApdTpdCpdAp dCpdApdTpdGpdAp-3' 35 10873.13 339000 Qin, L., et al.(2009). "The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis." Clin Chem Lab Med, 47(4), 405-411. doi: 10.1515/CCLM.2009.097

RNA Protein Affinity (Kd) 9.5 nM Binding Buffer (50mM Tris-HCl, pH 7.6, 1 M NaCl, 10mM 2-mercaptoethanol, 10% glycerol) at 4°C overnight at -20°C until use 5'-rUprUprGprCprUprUprGprGprAprAprUprGprCprGprUprUprAprUprAprGprUprCprUprCprUprUprAprGprGprUprGprUprGprUprAp 35 11178.67 352800 Mori, Y. (2012). Inhibitory RNA aptamer against sp6 RNA polymerase. Biochemical and Biophysical Resarch Communications, 420 (2012), 440-443.

2'-F-RNA Protein Affinity (Kd) 1.72 pM 30 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 2mM DTT, and 1% BSA N/A Counter Targets: CXCL-1 and CXCL-2 IL-8 5'-rGprGprGprGprGpfCpfUpfUprApfUpfCprApfUpfUpfCpfCprApfUpfUpfUprAprGpfUprGpfUpfUprApfUprGprApfUprAprApfCpfCp-3' 35 11182.56 353800 Sung HJ, Choi S, Lee JW, Ok CY, Bae YS, Kim YH, Lee W, Heo K, Kim IH. Inhibition of human neutrophil activity by an RNA aptamer bound to interleukin-8. Biomaterials. 2014 Jan;35(1):578-89. doi: 10.1016/j.biomaterials.2013.09.107. Epub 2013 Oct 13.

DNA Other Affinity (Kd) 2.15 nM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid sodium salt (HEPES) buffer (pH 7.3). N/A 5'-dGpdGpdGpdGpdApdCpdTpdGpdTpdTpdGpdTpdGpdGpdTpdApdTpdTpdApdTpdTpdTpdTpdTpdGpdGpdTpdTpdGpdTpdGpdCpdApdGpdTp-3' 35 10916.17 332500 Zhu, YF., Wang, YS., Zhou, B. et al. Anal Bioanal Chem (2017). doi:10.1007/s00216-017-0436-1.

DNA Protein Affinity (Kd) 321 nM PBS Predicted to form a G-quadruplex. 5'-dTpdApdTpdGpdGpdTpdApdTpdGpdCpdTpdGpdTpdGpdTpdGpdGpdTpdApdTpdGpdGpdGpdGpdTpdGpdGpdCpdGpdTpdGpdCpdTpdCpdTp-3' 35 Liang S, Kinghorn AB, Voliotis M, et al. Measuring luteinising hormone pulsatility with a robotic aptamer-enabled electrochemical reader. Nat Commun. 2019;10(1):852. Published 2019 Feb 20. doi:10.1038/s41467-019-08799-6

DNA Protein Affinity (Kd) 670 nM Not described Not described Specific for PvLDH over PfLDH Modified with cubane functionalized thymines 5'-dGpdGpdTpdApdTpdApdGpdApdCpdCpdCpdCpdTpdGpdApdGpdTpdCpdCpdTpdApdCpdCpdGpdApdGpdGpdGpdCpdApdCpdGpdGpdCpdAp-3' 35 Cheung, Y.-W., Röthlisberger, P., Mechaly, A. E., Weber, P., Levi-Acobas, F., Lo, Y., … Tanner, J. A. (2020). Evolution of abiotic cubane chemistries in a nucleic acid aptamer allows selective recognition of a malaria biomarker. Proceedings of the National Academy of Sciences, 202003267. doi:10.1073/pnas.2003267117

DNA Protein Affinity (Kd) 123.62 ± 17.53 nM Washing Buffer: 0.01 M DPBS, 5 mmol/L MgCl2, and 4.5 mg/mL glucose Blocking Buffer: Washing Buffer with additional 0.1 mg/mL yeast tRNA, 1 mg/mL BSA, and 0.5 mg/mL salmon DNA (Solarbio) Binding Buffer: Washing Buffer with additional 1 mg/L bovine serum albumin (BSA, Dingguo) and 0.1 mg/mL yeast tRNA (Sigma) The initial ssDNA library (5 nmol) was dissolved in 100 μL of binding buffer and then heated at 95 °C for 5 min and immediately cooled on ice for 10 min 5'-dApdGpdGpdCpdCpdCpdGpdCpdCpdGpdGpdGpdTpdGpdGpdGpdTpdGpdGpdGpdGpdGpdGpdGpdTpdTpdTpdGpdCpdGpdGpdGpdCpdCpdTp-3' 35 Li, L., Wan, J., Wen, X., Guo, Q., Jiang, H., Wang, J., … Wang, K. (2021). Identification of a New DNA Aptamer by Tissue-SELEX for Cancer Recognition and Imaging. Analytical Chemistry, 93(19), 7369–7377. doi:10.1021/acs.analchem.1c01445

DNA Protein Affinity (Kd) 0.4-0.6 nM This is a truncated sequence cut from 5'-GCATCGGAAPGAAPGPCPGCCPPGCACPGGPGCGGPCCGAPPGPGAGGGA-3', a SOMAmer. P=NapdU. 5'-dTpdCpdGpdGpdApdApdTpdGpdApdApdTpdGpdTpdCpdTpdGpdCpdCpdTpdTpdGpdCpdApdCpdTpdGpdGpdTpdGpdCpdGpdGpdTpdCpdCp-3' 35 Gelinas, A. D., Tan, T. K., Liu, S., Jaramillo, J. G., Chadwick, J., Harding, A. C., Zhang, C., Ream, B. E., Chase, C. N., Otis, M. R., Lee, T., Schneider, D. J., James, W. S., & Janjic, N. (2023). Broadly neutralizing aptamers to SARS-COV-2: A diverse panel of modified DNA antiviral agents. Molecular Therapy - Nucleic Acids, 31, 370–382. https://doi.org/10.1016/j.omtn.2023.01.008

DNA Other LOD 11.4 µM 1x Buffer (300 mM NaCl, 50mM KCl, 10 mM MgCl2, and 50 mM Tris) NA 5'-dApdGpdCpdTpdTpdGpdCpdTpdGpdCpdApdGpdCpdGpdApdTpdTpdCpdTpdTpdGpdApdTpdCpdGpdCpdCpdApdCpdApdGpdApdGpdCpdTp-3' 35 11550 Li WANG, Hua YE, Hong-Qing SANG, Dan-Dan WANG, Aptamer-Based Fluorescence Assay for Detection of Isocarbophos and Profenofos, Chinese Journal of Analytical Chemistry, Volume 44, Issue 5, 2016, Pages 799-803, ISSN 1872-2040, https://doi.org/10.1016/S1872-2040(16)60933-7.

RNA Protein Affinity (Kd) 0.00172 nM 200 μl of binding buffer [30 mm Tris–HCl (pH 7.5), 150 mm NaCl, 1.5 mm MgCl2, 2 mm DTT, and 1% BSA] for 30 min at room temperature, with gentle shaking 5'-rGprGprGprGprGprCprUprUprAprUprCprAprUprUprCprCprAprUprUprUprAprGprUprGprUprUprAprUprGprAprUprAprAprCprCp-3' 35 11450.8 g/mole 363500 L/(mole·cm) Sung HJ, Choi S, Lee JW, Ok CY, Bae YS, Kim YH, Lee W, Heo K, Kim IH. Inhibition of human neutrophil activity by an RNA aptamer bound to interleukin-8. Biomaterials. 2014 Jan;35(1):578-89. doi: 10.1016/j.biomaterials.2013.09.107. Epub 2013 Oct 13. PMID: 24129312.

DNA Protein Affinity (Kd) 16.8 nM Binding Buffer: 20mM Trisƒ??HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl₂) For details on pL1's use in colorimetric testing, see: Lee S, Manjunatha DH, Jeon W, Ban C (2014) Cationic Surfactant-Based Colorimetric Detection of Plasmodium Lactate Dehydrogenase, a Biomarker for Malaria, Using the Specific DNA Aptamer. PLoS ONE 9(7): e100847. doi:10.1371/journal.pone.0100847 5'-dGpdTpdTpdCpdGpdApdTpdTpdGpdGpdApdTpdTpdGpdTpdGpdCpdCpdGpdGpdApdApdGpdTpdGpdCpdTpdGpdGpdCpdTpdCpdGpdApdApdCp-3' 36 11163.29 340000 Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.

DNA Protein Affinity (Kd) 38.7 nM Binding Buffer: 20mM Trisƒ??HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl₂) Denatured at 90°C for 3 min and then incubated at 4°C for 1 h. For details on pL1's use in colorimetric testing, see: Lee S, Manjunatha DH, Jeon W, Ban C (2014) Cationic Surfactant-Based Colorimetric Detection of Plasmodium Lactate Dehydrogenase, a Biomarker for Malaria, Using the Specific DNA Aptamer. PLoS ONE 9(7): e100847. doi:10.1371/journal.pone.0100847 5'-dGpdTpdTpdCpdGpdApdTpdTpdGpdGpdApdTpdTpdGpdTpdGpdCpdCpdGpdGpdApdApdGpdTpdGpdCpdTpdGpdGpdCpdTpdCpdGpdApdApdCp-3' 36 11163.29 340000 Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.

Chimeric Protein Affinity (Kd) 20 nM SP buffer: 50 mM Tris HCl, pH 7.4, 50 mM NaCl, 100 mM KCl, 5 mM CaCl₂, 1 mM Magnesium Acetate. Labels: Grade I Pilocytic astrocytoma, Grade I Meningioma, Grade II Astrocytoma, Grade II Ependymoma, Grade III Anaplastic astrocytoma, Grade IV Glioblastoma, Grade IV medulloblastoma, Grade IV lymphoma. Does not label healthy brain tissue. This aptamer is a truncated and modified version of FB3 5'-fUpmGpfCpfCpfCpfUpmGpfCpfCpfCpfUpfCpmApfCpfCpfCpmGpfUpfUpmApmGpfCpfCpfUpmGpmApmGpfCpmGpfCpfCpfCpfCpmGpfCpmAp-3' 36 11563.12 311900 S Gomes et al. A 99mTc-MAG3-aptamer for imaging human tumours associated with high level of matrix metalloproteinase-9. Bioconjugate Chem. (2012). Accepted for print. DOI: 10.1021/bc300146c.

DNA Protein Affinity (Kd) N/A µM Borate buffer (pH 8.4); Room Temperature (30 min) 5'-dTpdTpdTpdTpdTpdTpdApdTpdCpdApdGpdGpdGpdCpdTpdApdApdApdGpdApdGpdTpdGpdCpdApdGpdApdGpdTpdTpdApdCpdTpdTpdApdGp-3' 36 11144.35 356800 J Zhao et al. High-Resolution and Universal Visualization of Latent Fingerprints Based on Aptamer-Functionalized Core-Shell Nanoparticles with Embedded SERS Reporters. ACS Appl. Mater. Interfaces 8(2016): 14389-14395.

RNA Cells Affinity (Kd) 146 nM DPBS with Ca2+ and Mg2+ (ThermoFisher, Waltham, MA) 65°C for 5 min and 4°C for 5 min PrEC cells only exhibit minimal uptake of E3 During SELEX, aptamers were refolded at 85C for 5 min in HEPES buffered saline with 1 mM MgCl2, 1 mM CaCl2, 2.7 mM KCl, then cooled on ice. Aptamer also tested against cell lines 22RV1 (Kd = 204 nM) and VCaP (Kd = 358 nM) Sequence is regular RNA: GGCUUUCGGGCUUUCGGCAACAUCAGCCCCUCAGCC 5'-rGprGprCprUprUprUprCprGprGprGprCprUprUprUprCprGprGprCprAprAprCprAprUprCprAprGprCprCprCprCprUprCprAprGprCprCp-3' 36 Powell Gray B, Kelly L, Ahrens DP et al. Tunable cytotoxic aptamer-drug conjugates for the treatment of prostate cancer. Proc. Natl. Acad. Sci. U.S.A. doi: 10.1073/pnas.1717705115 (2018)

DNA Protein Affinity (Kd) 956 µM A Thiol-C6-modification is present at the 3' end to allow the aptamer to bind to the cargo molecule. See reference. 5'-dCpdApdCpdCpdTpdGpdGpdGpdGpdGpdApdGpdTpdApdTpdTpdGpdCpdGpdGpdApdGpdGpdApdApdGpdGpdTpdTpdCpdCpdApdGpdGpdTpdGp-3' 36 V. C. Özalp, D. Çam, F. J. Hernandez, L. I. Hernandez, T. Schäfer, and H. A. Öktem, Small molecule detection by lateral flow strips via aptamer-gated silica nanoprobes, Analyst, 2016, 141, 2595.

DNA Small Organic Affinity (Kd) 269.25 ± 90.65 nM Not explicitly provided in the study Likely follows standard DNA aptamer refolding: heating, cooling, and buffer incubation Stronger binding to 4VA compared to ap-3, ap-5, and ap-9. No reported binding to structurally unrelated compounds Identified through BLI-SELEX screening Optimized into a truncated form (ap-21-CUT) for improved affinity (Kd: 269.25 ± 90.65 nM) Exhibits higher stability and affinity, making it the best candidate for sensor development 5'-dApdTpdCpdTpdCpdTpdApdGpdApdGpdGpdApdTpdCpdCpdCpdCpdGpdGpdGpdTpdGpdGpdApdCpdApdCpdGpdGpdTpdGpdGpdCpdTpdTpdAp-3' 36 ~11,880 Da Hu, M., Wang, J., Liu, H., Chen, Q., Xie, C., Li, Q., Sun, J., Liao, D., Liu, Y., & Liu, H.-B. (2023). Development of functional nucleic acid sensor for detection of locust pheromone 4-vinylanisole. Chemical Engineering Journal, 466, 143065

DNA Protein Affinity (Kd) ~10 nM The buffer is RPMI with 10% FBS, incubated at 37 °C (handled at room temperature). It uses 1 nmol per 10⁶ cells to detect IFNγ within 48 hours, anchored by 3′-CholTEG membrane insertion. Resuspend at 10 µM in nuclease-free water, heat to 95 °C for 5 min, snap-cool on ice for 5 min, equilibrate at room temp for 30 min, then add to cells (1–2 nmol/10⁶ cells). Highly specific to human IFNγ, with no response to unrelated antigens or IFNG-knockout T cells. No signal with non-target aAPCs. Molecular beacon aptamer for cytokine-based TCR screening; flow cytometry-compatible with reversible stem-loop signaling. dApdGpdGpdGpdGpdTpdTpdGpdGpdTpdTpdGpdTpdGpdTpdTpdGpdGpdGpdTpdGpdTpdTpdGpdTpdGpdTpdCpdCpdApdApdCpdCpdCpdCpdTp 36 Approx. 10,700 – 11,000 Da 354,000 M⁻¹cm⁻¹ Luo, S., Notaro, A., & Lin, L. (2025). ATLAS-seq: a microfluidic single-cell TCR screen for antigen-reactive TCRs. Nature Communications, 16, 216. https://doi.org/10.1038/s41467-024-54675-3

RNA Small Organic Affinity (Kd) 3 µM Binding buffer: 30 mM Trisƒ??acetate(pH 7.5), 60 mM magnesium acetate, 120 mM potassium acetate, and 120 mM ammonium acetate. in Binding buffer, heat to 55° C for 15 minutes and slowly let cool to RT. 5'-rGprGprUprGprAprUprAprCprCprGprCprCprCprAprAprGprAprGprUprUprCprAprUprAprUprCprGprAprCprGprGprCprGprGprUprGprUp-3' 37 11910.22 366600 Ko, J. et al. "Identification of a structural motif of 23S rRNA interacting with 5S rRNA." FEBS Letters, 508 (2001): 300-304.

DNA Small Organic Affinity (Kd) 272 nM Binding Buffer (20 mM Tris-HCl (pH 7.4), 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, and 0.05% v/v Tween-20) 5'-dApdCpdCpdApdTpdCpdTpdGpdTpdGpdTpdApdApdGpdGpdGpdGpdTpdApdApdGpdGpdGpdGpdTpdGpdGpdGpdGpdGpdTpdApdCpdGpdTpdCpdTp-3' 37 11581.57 366800 Wochner et al. "A DNA aptamer with high affinity and specificity for therapeutic anthracyclines." Analytical Biochemistry, 373(2008): 34-42.

RNA Protein Affinity (Kd) N/A nM Washed with PBS and 0.9 mM CaCl₂, 0.5 mM MgCl₂, 2.67 mM KCl, 1.47 mM KH₂PO₄, 135 mM NaCl, and 8 mM Na₂. See also PF377 P-Selectin Aptamer for an aptamer that also decreases sickled RBC binding to HUVECs. 5'-rUprUprCprAprAprCprGprCprUprGprUprGprAprAprGprGprGprCprUprUprAprUprAprCprGprAprGprCprGprGprAprUprUprAprCprCprCp-3' 37 11855.18 364200 Brunette et al. "RNA Aptamer Therapy for Vaso-Occlusion in Sickle Cell Disease." Nucleic Acids Therapeutics, 21(2011): 275-283. Mi et al. "Targeted inhibition of av??3 integrin with an RNA aptamer impairs endothelial cell growth and survival." Biochemical and Biophysical Research Communications, 338(2005): 956-963.

Chimeric Protein Affinity (Kd) 43 nM Binding Buffer: RPMI 1640, 4.5 g/L glucose, 5 mM MgCl₂ in vivo (20 mM MgCl₂ in vitro), 100 mg/L tRNA and 100 mg/L BSA. Binds to Ramos and SKLY-16 cell lines and CLL and HCL clinical samples.
Variable binding to Daudi cell line.
Partial binding to normal B cells. The monomer does not bind at 37°C (Kd > 10,000 nM). Aptamer was trimerized using PEG linkers. This increased the stability and binding affinity of the aptamer at higher temperatures (Kd = 256 nM at 37°C / Kd = 7.9).

This aptamer is a truncated version of TD05 below.

The four nucleotides at the 3'-tail were replaced with linked nucleic acids to strengthen the stem. 5'-dApdGpdGpdApdGpdGpdApdTpdApdGp dTpdTpdCpdGpdGpdTpdGpdGpdCpdTp dGpdTpdTpdCpdApdGpdGpdGpdTpdCp dTpdCpdCpbTnbCnbCnbTn-3' 37 10256.7 349100 R Mallikaratchy et al. "A multivalent DNA aptamer specific for the B-cell receptor on human lymphoma and leukemia." Nucleic Acids Res. 39(2011): 2458-2469.

RNA Protein Affinity (Kd) 120 pM Binding Buffer: 50 mM Tris-HCl (pH 7.8) and 50 mM KCl 5'- rAprCprGprAprAprGprCprUprUprGp rAprUprCprCprCprGprUprUprUprGp rCprCprGprGprUprCprGprAprUprCp rGprCprUprUprCprGprAp-3' 37 11784.08 352600 R Yamamoto et al. A novel RNA motif that binds efficiently and specifically to the Tat protein of HIV and inhibits the trans-activation by Tat of transcription in vitro and in vivo. Genes to Cells 5(2000):371-388

DNA Other Affinity (Kd) 87.03 nM PBS containing 1.4mM MgCl2 NA 5'- dCpdCpdCp dTpdCpdCp dGpdGpdGp dGpdGpdGp dGpdTpdCp dApdTpdCp dGpdGpdGp dApdTpdAp dCpdCpdTp dGpdGpdTp dApdApdGp dGpdApdTp dAp -3' 37 11471.4 358700 S. Marton, F. Cleto, M.A. Krieger, J. Cardoso, Isolation of an aptamer that binds specifically to E. coli, PLoS One. 11 (2016) 1–17, https://doi.org/10.1371/journal.

DNA Cells Affinity (Kd) 43 nM RPMI 1640 and 4.5 g/l glucose and 5 mM MgCl2 None BNA residues in red 5'-dApdGpdGpdApdGpdGpdApdTpdApdGpdTpdTpdCpdGpdGpdTpdGpdGpdCpdTpdGpdTpdTpdCpdApdGpdGpdGpdTpdCpdTpdCpdCpbTnbCnbCnbTn-3' 37 Mallikaratchy, P. R., Ruggiero, A., Gardner, J. R., Kuryavyi, V., Maguire, W. F., Heaney, M. L., McDevitt, M. R., Patel, D. J., & Scheinberg, D. A. (2011). A multivalent DNA aptamer specific for the B-cell receptor on human lymphoma and leukemia. Nucleic acids research, 39(6), 2458–2469. https://doi.org/10.1093/nar/gkq996

DNA Protein Affinity (Kd) 0.17 nM 4.5 g/L glucose, 5 mM MgCl2, 0.1 mg/mL yeast tRNA, and 1 mg/mL bovine serum albumin NA In the sequence: D - Gemcitabine 5'-dGpdTpdGpdApdApdTpdTpdGpdCpdGpdTpdTpdGpdApdApdTpdTpdApdTpdGpdTpdDpdDpdDpdTpdTpdCpdApdGpdTpdCpdApdTpdCpdApdCp dTp -3' 37 11399.4 358601.769336 Park, J. Y., Chae, J. R., Cho, Y. L., Kim, Y., Lee, D., Lee, J. K., & Kang, W. J. (2020). Targeted Therapy of Hepatocellular Carcinoma Using Gemcitabine-Incorporated GPC3 Aptamer. Pharmaceutics, 12(10), 985. doi:10.3390/pharmaceutics12100985

RNA Protein Affinity (Kd) 4.47 nM Binding buffer [20 mM sodium phosphate (pH 6.5), 2 mM magnesium acetate, 200 mM potassium acetate, 5% glycerol, 0.05% Triton X-100, 5 mM b-mercaptoethanol]. Binding buffer [20 mM Tris/HCl (pH 7.5) containing 50 mM KCl and 1 mM DTT]. NA 5'-rGprGprGprUprUprUprUprCprGprGprGprAprUprAprCprGprCprGprGprAprGprGprGprUprGprGprGprCprAprAprUprAprAprCprCprCprCp-3' 37 11413.3 348600 Fukunaga, Junichi et al. “A G-quadruplex-forming RNA aptamer binds to the MTG8 TAFH domain and dissociates the leukemic AML1-MTG8 fusion protein from DNA.” FEBS letters vol. 594,21 (2020): 3477-3489. doi:10.1002/1873-3468.13914

RNA Protein Affinity (Kd) N/A nM 140 mM NaCL, 2.7 mM KCl, 10 mM Na2HPO4-, 2mM KH2PO4, pH 7.4 Researchers noted that generated aptamers have low specificity but high sensitivity. N/A 5'-rUprAprAprUprAprCprGprAprCprUprCprAprCprUprAprUprAprGprGprGprAprAprUprUprCprGprAprGprCprUprCprGprGprUprAprCprCp-3' 37 11900 373800 Rahimi F, Murakami K, Summers JL, Chen C-HB, Bitan G (2009) RNA Aptamers Generated against Oligomeric Ab40 Recognize Common Amyloid Aptatopes with Low Specificity but High Sensitivity. PLoS ONE 4(11): e7694.

RNA Small Organic Affinity (Kd) 1 µM Selection buffer: 0.1 M KCl, 5 mM MgCl₂, 10 mM Na-HEPES (pH 7.4) 5'-rGprGprAprUprCprCprCprGprAprCprUprGprGprCprGprAprGprAprGprCprCprAprGprGprUprAprAprCprGprAprAprUprGprGprAprUprCprCp-3' 38 12300.52 377500 Grate, Dilara and Wilson, Charles. "Laser-mediated, site-specific inactivation of RNA transcripts." PNAS, 96 (1999): 6131-6136

RNA Small Organic Affinity (Kd) 100 nM Buffer A (100 mM Hepes (pH 7.3), 5 mM MgCI2, and 0.5 M NaCI) Truncated version from Figure 2 in paper. Arrows indicate truncation. Binds to theophylline with 10,000 times greater affinity than caffeine, which differs only by a methyl group. 5'-rAprGprUprGprAprUprAprCprCprAprGprCprAprUprCprGprUprCprUprUprGprAprUprGprCprCprCprUprUprGprGprCprAprGprCprAprCprUp-3' 38 12097.29 364600 Jenison et al. "High-resolution molecular discrimination by RNA." Science, 263(1994): 1425-1429.

DNA Small Organic Affinity (Kd) 8.32 µM Binding Buffer: 100 mM NaCl, 20 mM Trisƒ??HCl [pH 7.6], 2 mM MgCl₂, 5 mM KCl, 1 mM CaCl₂, and 0.02% Tween 20 5'-dApdApdGpdCpdGpdCpdGpdCpdGpdApdGpdApdCpdTpdApdCpdGpdTpdTpdTpdGpdTpdApdGpdGpdGpdApdTpdApdCpdCpdGpdApdTpdGpdTpdCpdGp-3' 38 11783.7 374200 Shengmin, X. (2012). Selection of dna aptamers against polychlorinated biphenyls as potential biorecognition elements for environmental analysis. Analytical Biochemistry, 423(2012), 195-201.

DNA Protein Affinity (Kd) 31.7 nM Binding Buffer: 20mM Trisƒ??HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl₂) 5'-dGpdApdApdCpdTpdCpdApdTpdTpdGpdGpdCpdTpdGpdGpdApdGpdGpdCpdGpdGpdCpdApdGpdTpdApdCpdCpdGpdCpdTpdTpdGpdApdGpdTpdTpdCp-3' 38 11750.66 358500 Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.

DNA Protein Affinity (Kd) 49.6 nM Binding Buffer: 20mM Trisƒ??HCl pH 8.0, 50mM NaCl, 5mM KCl, and 5mM MgCl₂) 5'-dGpdApdApdCpdTpdCpdApdTpdTpdGpdGpdCpdTpdGpdGpdApdGpdGpdCpdGpdGpdCpdApdGpdTpdApdCpdCpdGpdCpdTpdTpdGpdApdGpdTpdTpdCp-3' 38 11750.66 358500 Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.

2'-F-RNA Protein Ki 100 nM Binding Buffer: Phosphate-buffered saline with 1 mM MgCl₂.
Incubated in the presence or absence of trypsin (between 0.3 and 0.0001 μg/ml) 5'-fCprGprApfUprGpfCprGprGpfUpfCp fUpfCprApfUprGpfCprGpfUpfCprGp rAprGpfUprGpfUprGprAprGpfUpfUp fUprApfCpfCpfUpfUpfCprGp -3' 38 12189.15 365900 G Biesecker et al.. "Derivation of RNA aptamer inhibitors of human complement C5." Immunopharmacology 42(1999):219-230

DNA Small Organic Affinity (Kd) 0.4 µM Phosphate buffer: 20 mM, pH7, 200 mM NaCl. Did not bind to metabolites benzoyl ecgonine or ecgonine methyl ester. This aptamer is predicted to form a three-way junction in the presence of cocaine. 5'-dGpdGpdGpdApdGpdApdCpdApdApdGpdGpdApdApdApdApdTpdCpdCpdTpdTpdCpdApdApdTpdGpdApdApdGpdTpdGpdGpdGpdTpdCpdGpdApdCpdAp-3' 38 11833.78 392900 M Stojanovic, P de Prada, and D Landry. Aptamer-based folding fluorescent sensor for cocaine. J. Am. Chem. Soc. 123(2001): 4928-4931.

DNA Small Organic Affinity (Kd) 2.9 nM 100 μM concentration of monomeric Cp*Rh(III) Mix and incubate for 5 min at 95oC, and cool down at room temperature > 30 min N/A 5'-dCpdTpdCpdTpdCpdGpdGpdGpdApdCpdGpdApdCpdGpdGpdCpdCpdCpdGpdApdTpdCpdTpdCpdApdGpdApdGpdTpdApdGpdTpdCpdGpdTpdCpdCpdCp-3' 38 11616.53 380810 Yang KA, Barbu M, Halim M, et al. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat Chem. 2014;6(11):1003-1008. doi:10.1038/nchem.2058

2'-F-RNA Protein Affinity (Kd) 2.4 nM TBSMC buffer (20 mM Tris, pH 7.4; 137 mM NaCl; 1 mM CaCl2; 1 mM MgCl2) NA Aptamer was modified post selection from a 2'F library. Note that there is an internal PEG4 linker between G9 and C10. This linker stabilizes the secondary structure and is critical for binding. 5'-bGnbGnbGnbAnbGnmGpmApfCprGpfCprGpfUpfCprGpfCpfCprGpfUpmApmApfUpmGpmGpmApfUpmGpfUpfUpfUpfUpmGpbCnbUnbCnbCnbCnfUpmGp-3' 38 Schmidt KS, Borkowski S, Kurreck J, Stephens AW, Bald R, Hecht M, et al. Application of locked nucleic acids to improve aptamer in vivo stability and targeting function. Nucleic Acids Res 2004; 32:5757- 65; PMID:15509871; http://dx.doi.org/10.1093/nar/ gkh862

DNA Antibody Affinity (Kd) 22.6 nM 1× PBS containing 2 mM MgCl2 - (PBSM) authors demonstrated specificity by florescence intensity 5'-dCpdGpdCpdCpdCpdGpdTpdGpdTpdTpdTpdApdTpdCpdCpdGpdTpdTpdTpdGpdCpdTpdCpdTpdTpdApdGpdTpdGpdGpdCpdApdCpdGpdGpdGpdGpdGp-3' 38 11778.57 Bai, cheng, et al." Surface acoustic wave‑assisted microfluidic isolation of aptamers." Microfluidics and Nanofluidics, 26(2002): 1-10

DNA Protein Affinity (Kd) 11 nM Buffer A (30 mM Trisƒ??HCl (pH 8.5), 40 mM ammonium sulfate, 20 mM magnesium chloride, and 0.01% 2-mercaptoethanol) 5'-dCpdGpdGpdTpdCpdGpdCpdTpdCpdCpdGpdTpdGpdTpdGpdGpdCpdTpdTpdGpdGpdGpdTpdTpdGpdGpdGpdTpdGpdTpdGpdGpdCpdApdGpdTpdGpdApdCp-3' 39 12149.88 356700 Pileur, et al. "Selective inhibitory DNA aptamers of the human RNase H1." Nucleic Acids Research, 31 (2003): 5776-5788.

DNA Protein Affinity (Kd) 8 nM Selection Buffer: PBS-T (10 mM Na₂HPO₄, 2 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl, and 0.05%Triton-X; pH 7.5) with added 0.1 μg/ml poly-dIdC and 1 μg/ml BSA. Binds to the MT32 coat protein with reduced affinity (290 nM). 5'-dApdGpdCpdApdApdGpdGpdTpdTpdTpdGpdGpdTpdGpdTpdTpdGpdGpdTpdTpdGpdGpdTpdTpdGpdCpdTpdGpdGpdTpdTpdTpdTpdGpdGpdTpdTpdTpdCp-3' 39 12158.96 361100 Balogh, et al. "Selection and versatile application of virus-specific aptamers." FASEB Journal, 24(2010): 4187-4195.

2'-F-RNA Protein Affinity (Kd) 10 nM Buffer used for Binding Assays: PBS with 0.01% BSA. Incubation Time: 15 minutes. 85°C for 5 minutes in DMEM serum free, snap-cooled on ice for 2 minutes, gradual warming to 37°C (from article reference [34]) High affinity for human extracellular EGFR (both disulfide-linked EGFR dimer and reduced EGFR monomer). No appreciable binding to extracellular ErbB3. This apatamer was shown to induce apoptosis in A549 cells and inhibit tumor growth in human non-small-cell lung cancer xenograft mice. 5'-rGpfCpfCpfUpfUprAprGpfUprAprApfCprGpfUprGpfCpfUpfUpfUprGprApfUprGpfUpfCprGprApfUpfUpfCprGprApfCprAprGprGprAprGprGpfCp-3' 39 12561.44 386200 CL Esposito et al. A neutralizing RNA aptamer against EGFR causes selective apoptotic cell death. PLoS One 6(2011):e24071.

DNA Other Affinity (Kd) EC50 =/< 80 nM 90% High Glucose DMEM, 10% Fetal Bovine Serum. Tested in vivo. 5'-dGpdGpdGpdApdCpdCpdTpdApdTpdCpdApdGpdGpdCpdGpdApdTpdGpdTpdGpdApdApdApdApdCpdTpdCpdTpdTpdApdTpdApdCpdCpdApdCpdTpdGpdGp-3' 39 12015.87 380500 Muharemagic D, Zamay A, Ghobadloo SM, Evgin L, Savitskaya A, et al. (2014) Aptamer-Facilitated Protection of Oncolytic Virus from Neutralizing Antibodies. Molecular Therapy--Nucleic Acids 3, e167. doi: 10.1038/mtna.2014.19

DNA Protein Affinity (Kd) 510 pM PBS 5'-dGpdCpdGpdTpdGpdCpdApdGpdCpdApdTpdGpdApdCpdCpdApdCpdCpdGpdApdTpdGpdTpdCpdApdCpdApdCpdTpdTpdApdApdTpdGpdApdGpdApdApdTp-3' 39 Aptamer-Based Sandwich Assay for Measurement of Thymidine Kinase 1 in Serum of Cancerous Patients Mahmood Nazari, Seyed Latif Mousavi Gargari, Abbas Sahebghadam Lotfi, Mohammad Javad Rassaee, and Ramezan Ali Taheri Biochemistry 2019 58 (18), 2373-2383

DNA Small Organic Affinity (Kd) 150 nM 20 mM Tris at pH 7.5 with 100 mM NaCl, 2 mM MgCl2, 5 mM KCl and 1 mM CaCl2, RT Heated to 65°C for 5 minutes then cooled to RT for 30 minutes 5'-dGpdGpdGpdCpdGpdApdGpdApdApdCpdApdGpdTpdGpdTpdCpdCpdCpdApdGpdTpdCpdGpdCpdTpdApdGpdTp dTpdTpdTpdCpdTpdCpdTpdGpdCpdCpdCp-3' 39 11950.7 Lee, K.H., Zeng, H. A general double library SELEX strategy for aptamer selection using unmodified nonimmobilized targets. Anal Bioanal Chem 409, 5081–5089 (2017).

DNA Small Organic Affinity (Kd) 20.8 nM 1% BSA, 0.1% Tween-20, 0.2 mg/mL of tRNA, DPBS, pH 7.4. NA 5′-dTpdGpdGpdCpdApdApdGpdApdGpdGpdGpdTpdGpdTpdGpdCpdTpdTpdApdApdGpdGpdTpdGpdGpdApdCpdApdCpdGpdGpdTpdGpdGpdCpdTpdTpdApdGp-3′ 39 12223.9 384000 Wu, S.; Liu, Y.; Sun, H.; Zhong, M.; Dai, B.; Pan, B.; Shen, Z. An ssDNA aptamer specific for detection and purification of hexahistidine-tagged proteins. Anal. Biochem. 2020 Oct 15; 607: 113893. DOI: 10.1016/j.ab.2020.113893.

RNA Protein Affinity (Kd) 30 nM 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2, pH 7.4) Denature at 95°C for 5 minutes, place on ice (4°C) for 5 minutes, room temperature (23°C) for 10 minutes. high affinity and specificity for sGP Also has high affinity and specificity to the Sudan virus (SUDV) sGP. 5'-rGprGprGpfCprGpfCpfUpfCprAprApfUpfUpfUpfUpfUpfUprApfUpfUprGpfCprApfUpfUpfUpfUpfUpfCpfUpfUpfUprGprAprGpfCprGpfCpfCpfCp-3' 39 12.297 369000 Shubham, S., Hoinka, J., Banerjee, S. et al. A 2′FY-RNA Motif Defines an Aptamer for Ebolavirus Secreted Protein. Sci Rep 8, 12373 (2018). https://doi.org/10.1038/s41598-018-30590-8

RNA Protein Affinity (Kd) 6.62x10^-10 nM In this study, an aptamer library consisting of 810 pmol was used in PBS as a binding buffer. The library was subjected to a heat treatment at 95°C for 5 minutes, followed by rapid cooling on an ice bath. The cooled library was then mixed with 70 μl of magnetic beads (MB) and incubated at 4°C with gentle shaking for 1 hour. After incubation, unbound aptamers were removed by precipitation, and the resulting supernatant was retained. This supernatant was combined with 70 μl of another set of magnetic beads (NP-MB) and incubated for 90 minutes at 4°C with gentle shaking. The mixture was then precipitated using a magnet, and the supernatant was discarded. The collected pellet was washed with 70 μl of PBS, followed by suspension in 75 μl of RNase DNase-free water at 70°C. A portion of 15 μl from the suspended pellet was stored at -20°C, while the remaining 60 μl was employed as a template in 4 PCR reactions for subsequent rounds of SELEX (Systematic Evolution of Ligands by Exponential enrichment). This process enables the selection and amplification of target-specific aptamers for further study. ' 5'-dCpdCpdGpdTpdApdGpdGpdGpdTpdTpdApdGpdGpdGpdGpdCpdGpdGpdApdTpdCpdGpdTpdCpdApdGpdGpdGpdTpdGpdGpdApdTpdApdApdGpdGpdCpdAp-3' 39 2940.15 375 Jalali, T., Salehi-Vaziri, M., Pouriayevali, M. H., & Gargari, S. L. M. (2021). Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens. Scientific Reports, 11(1). https://doi.org/10.1038/s41598-021-91826-8

DNA Protein Affinity (Kd) 3.09 nM 1X TE Buffer Prepare 10 uM aptamer in 1X TE buffer, heat to 95C for 5 minutes, cool to room temperature for 15 minutes, then dilute further for use 5'-dGpdGpdGpdGpdGpdGpdCpdTpdGpdGpdTpdCpdApdGpdCpdGpdGpdTpdTpdCpdGpdApdTpdCpdCpdCpdGpdCpdTpdTpdApdGpdCpdTpdCpdCpdCpdCpdCp-3' 39 11968.7 Da 347300 L/(mole·cm) Nordin, N. A., Soon, S., Senawi, J. B., Jinin, Z. A. M., Arshad, S. S., Yasmin, A. R., & Azri, F. A. (2024). Aptamer-Based Detection of Foot-and-Mouth Disease Virus Using Single-Stranded DNA Probe. Applied Biochemistry and Biotechnology, 1-13.

RNA Small Organic Affinity (Kd) 700 nM Binding Buffer (300mM NaCl, 20 mM Tris (pH 7.6), 5mM MgCl2) 5'-rGprGprGprUprUprGprGprGprAprAprGprAprAprAprCprUprGprUprGprGprCprAprCprUprUprCprGprGprUprGprCprCprAprGprCprAprAprCprCprCp-3' 40 12928.86 388400 sassanfar and Szostak. "An RNA motif that binds ATP."

RNA Small Organic Affinity (Kd) 12 µM Selection Buffer (50 mM Hepes (pH 7.0), 250 mM NaCl, 5 mM each CaCl2 and MgCl2, and 1 mM glycine) 5'-rGprGprCprAprUprCprGprGprAprAprAprGprUprGprGprGprUprUprGprAprUprGprUprAprAprGprUprAprAprCprAprGprGprCprGprAprUprGprCprCp-3' 40 13017.94 410400 Majerfeld, et al. "RNA Affnity for Molecular L-Histidine; Genetic Code Origins." Journal of Molecular Evolution, 61 (2005): 226-235.

RNA Protein Affinity (Kd) 2.3 nM Binding Buffer (50 mM Tris, pH 7.5, 100 mM NaCl, 1 mM MgCl2, 30 µM ZnCl and 10 mM DTT) SSC buffer (17.5 mM sodium citrate (pH 7.0), 150 mM sodium chloride) 5'-rGprGprAprGprAprCprAprUprCprCprCprUprCprUprUprGprUprUprGprGprUprGprGprUprGprCprCprGprUprGprUprGprGprAprUprGprUprCprUprCp-3' 40 12814.65 381200 Berglund, A., et al. "A High Affinity Binding Site for the HIV-1 Nucleocapsid Protein." Nucleic Acids Research, 25(1997):1042-1049.

DNA Protein Affinity (Kd) 0.094 nM Selection Buffer: PBSM(10.1 mM Na₂HPO₄, 1.8 mM K₂HPO₄, 137 mM NaCl and 2.7 mM KCl, 1 mM MgCl₂ (pH 7.4)) Contains a terminal 3'-3'-linked thymidine residue to protect from 3' exonuclease degradation. 5'-dCpdApdCpdApdGpdGpdCpdTpdApdCpdGpdGpdCpdApdCpdGpdTpdApdGpdApdGpdCpdApdTpdCpdApdCpdCpdApdTpdGpdApdTpdCpdCpdTpdGpdTpdGpdTi-3' 40 12266 382300 Green, L., et al. "Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain." Journal of Biochemistry, 35(1996): 14413-14424.

DNA Protein Affinity (Kd) 55 nM Selection Buffer: PBS-T (10 mM Na₂HPO₄, 2 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl, and 0.05%Triton-X; pH 7.5) with added 0.1 μg/ml poly-dIdC and 1 μg/ml BSA. Binds to the PSA-H coat protein with similar affinity (83 nM). Most likely forms a g-quartet. 5'-dGpdGpdGpdGpdTpdGpdGpdTpdGpdGpdGpdTpdTpdCpdTpdTpdTpdTpdTpdGpdTpdGpdGpdTpdApdTpdTpdGpdGpdTpdGpdTpdGpdGpdGpdGpdGpdGpdCpdAp-3' 40 12619.23 380300 Balogh, et al. "Selection and versatile application of virus-specific aptamers." FASEB Journal, 24(2010): 4187-4195.

DNA Protein Affinity (Kd) 4.6 nM Selection Buffer (50mM K2HPO4, 150mM NaCl, 0.05% Tween 20 (pH 7.5)) 5'-dGpdCpdTpdApdTpdGpdGpdGpdTpdGpdGpdTpdCpdTpdGpdGpdTpdTpdGpdGpdGpdApdTpdTpdGpdGpdCpdCpdCpdCpdGpdGpdGpdApdGpdCpdTpdGpdGpdCp-3' 40 12488.1 370000 Kokpinar, et al. "Aptamer-Based Downstream Processing of His-Tagged Proteins Utilizing Magnetic Beads." Biotechnology and Bioengineering, 108(2011):2371-2379.

DNA Protein Affinity (Kd) 20 nM 10 mL of PBS (0..5% Tween 20) containing bead-bound PDZ-Myc-His₆ (5 uL) and 1 ug/mL BSA was incubated for 30 minutes with library. 5'-dTpdTpdGpdGpdGpdGpdApdGpdGpdGpdGpdCpdApdCpdTpdGpdGpdGpdCpdApdGpdTpdGpdTpdApdApdTpdTpdTpdApdCpdGpdApdApdApdGpdCpdGpdApdGp-3' 40 12546.21 400500 Tanaka et al. "In Vitro Selection and Characterization of DNA Aptamers Specific for Phospholamban." The Journal of Pharmacology and Experimental Therapeutics, 329(2009): 57-63.

DNA Small Organic Affinity (Kd) 4.02 µM Binding Buffer: 100 mM NaCl, 20 mM Trisƒ??HCl [pH 7.6], 2 mM MgCl₂, 5 mM KCl, 1 mM CaCl₂, and 0.02% Tween 20 5'-dGpdGpdCpdGpdGpdGpdGpdCpdTpdApdCpdGpdApdApdGpdTpdApdGpdTpdGpdApdTpdTpdTpdTpdTpdTpdCpdCpdGpdApdTpdGpdGpdCpdCpdCpdGpdTpdGp-3' 40 12415.09 378800 Shengmin, X. (2012). Selection of dna aptamers against polychlorinated biphenyls as potential biorecognition elements for environmental analysis. Analytical Biochemistry, 423(2012), 195-201.

DNA Protein Affinity (Kd) 7.5 µM PBS binding buffer for SPR: 137 mM NaCl, 2.7 mM KCl, 4.2 mM Na₂HPO₄, and 0.005% Tween 20. Heated to 90°C for 5 min, then cooled on ice. Selected using Monolex (1-step selection method). 5'-dGpdCpdGpdApdGpdGpdTpdGpdTpdTp dCpdGpdApdGpdApdGpdTpdTpdApdGp dGpdGpdGpdCpdGpdApdCpdApdTpdGp dApdCpdCpdApdApdApdCpdGpdTpdTp-3' 40 12466.15 398100 L H Lauridsen. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against a-bungarotoxin. PLoS ONE 7(2012): e41702.

2'-F-RNA Protein Affinity (Kd) 18 nM Binding Buffer: PBS (137 nM NaCl, 27 nM KCl, 100 nM Na₂HPO₄, 2 nM K₂HPO₄, pH 7.4) OPN-R3 prevents the binding of osteopontin to CD44 and a_v??₃. It was found to inhibit MDA-MB231 adhesion, migration, and invasion in Matrigel-based assays. 5'-fCprGprGpfCpfCprApfCprAprGprAp rApfUprGprAprAprAprAprApfCpfCp fUpfCprApfUpfCprGprApfUprGpfUp fUprGpfCprApfUprAprGpfUpfUprGp -3' 40 12862.72 402900 Z Mi et al. RNA aptamer blockade of osteopontin inhibits growth and metastasis of MDA-MB231 breast cancer cells. Molecular Therapy 17(2009): 153-161

Chimeric Protein Affinity (Kd) 18 nM Binding Buffer: PBS (137 nM NaCl, 27 nM KCl, 100 nM Na₂HPO₄, 2 nM K₂HPO₄, pH 7.4) This aptamer is a modified version of OPN-R3 in which the 2'-F-RNA residues have been replaced with 2'-O-Me RNA. The binding affinity was found to be identical to OPN-R3. The modified aptamer was used in vivo on xenograft mice and was found to decrease tumor growth and metastasis. 5'-mCprGprGpmCpmCprApmCprAprGprAprApmUprGprAprAprAprAprApmCpmCpmUpmCprApmUpmCprGprApmUprGpmUpmUprGpmCprApmUprAprGpmUpmUprGp-3' 40 13079.35 402900 Z Mi et al. RNA aptamer blockade of osteopontin inhibits growth and metastasis of MDA-MB231 breast cancer cells. Molecular Therapy 17(2009): 153-161
Li J, Yousefi K, Ding W, Singh J, Shehadeh LA. Osteopontin RNA aptamer can prevent and reverse pressure overload-induced heart failure. Cardiovasc Res. 2017 May 1;113(6):633-643. doi: 10.1093/cvr/cvx016. PMID: 28453726; PMCID: PMC7526752.