Aptagen, LLC
A8 (ID# 9082)
DNA
CD8+ T cell
Protein
2.4 nM (reported value)
Na+= 137mM; Mg++ = 5.5mM
4 °C°C
NA If the oligo is a known aptamer sequence: For binding studies, perform a refolding protocol to ensure proper function (i.e. binding to antigen or target). Refer to the aptamer reference source for the appropriate refolding parameters and binding conditions. Note: it is unknown whether aptamer functions properly without refolding.
/ATCCAGAGTGACGCAGCAGCTCGATCGTATAGCCGTGACGCAGCTTGAAATGGGATCGCG
TCCACAGTTTTGGACACGGTGGCTTAGdApdTpdCpdCpdApdGpdApdGpdTpdGpdApdCpdGpdCpdApdGpdCpdTpdCpdGpdApdTpdCpdGpdTpdApdTpdApdGpdCpdCpdGpdTpdGpdApdCpdGpdCpdApdGpdCpdTpdTpdGpdApdApdApdTpdGpdGpdGpdApdTpdCpdGpdCpdTp
87
27247.6 g/mole
847200 L/(mole·cm)
Note: Information on this aptamer oligo was obtained from the literature and hasn't been validated by Aptagen.
Kacherovsky N, Cardle II, Cheng EL, Yu JL, Baldwin ML, Salipante SJ, Jensen MC, Pun SH. Traceless aptamer-mediated isolation of CD8+ T cells for chimeric antigen receptor T-cell therapy. Nat Biomed Eng. 2019 Oct;3(10):783-795. doi: 10.1038/s41551-019-0411-6. Epub 2019 Jun 17. PMID: 31209354; PMCID: PMC6783348.
Have your aptamer oligo synthesized ORDER



We are always looking for ways to improve. Please tell us what you think.