Aptagen, LLC
DL650-E3 (ID# 7990)
RNA
PC-3
Cells
146 nM (reported value)
DPBS with Ca2+ and Mg2+ (ThermoFisher, Waltham, MA)
37°C
65°C for 5 min and 4°C for 5 min
PrEC cells only exhibit minimal uptake of E3
During SELEX, aptamers were refolded at 85C for 5 min in HEPES buffered saline with 1 mM MgCl2, 1 mM CaCl2, 2.7 mM KCl, then cooled on ice. Aptamer also tested against cell lines 22RV1 (Kd = 204 nM) and VCaP (Kd = 358 nM) Sequence is regular RNA: GGCUUUCGGGCUUUCGGCAACAUCAGCCCCUCAGCC
5'-rGprGprCprUprUprUprCprGprGprGprCprUprUprUprCprGprGprCprAprAprCprAprUprCprAprGprCprCprCprCprUprCprAprGprCprCp-3'
36
Note: Information on this aptamer oligo was obtained from the literature and hasn't been validated by Aptagen.
Powell Gray B, Kelly L, Ahrens DP et al. Tunable cytotoxic aptamer-drug conjugates for the treatment of prostate cancer. Proc. Natl. Acad. Sci. U.S.A. doi: 10.1073/pnas.1717705115 (2018)
Have your aptamer oligo synthesized ORDER
We are always looking for ways to improve. Please tell us what you think.