Forget Antibodies. Use Aptamers!™ Forget Antibodies. Use Aptamers!™
R&D Inquiry Quote
Contact Us

Apta-Index™: DL650-E3 (ID# 638)

Back to Search Results

DL650-E3 (ID# 638)

DL650-E3
* The secondary structure may not be accurate because of MFOLD limitations on chemistries other than RNA/DNA.
RNA PC-3 Cells 146 nM (reported value) DPBS with Ca2+ and Mg2+ (ThermoFisher, Waltham, MA) 65°C for 5 min and 4°C for 5 min During SELEX, aptamers were refolded at 85C for 5 min in HEPES buffered saline with 1 mM MgCl2, 1 mM CaCl2, 2.7 mM KCl, then cooled on ice. Aptamer also tested against cell lines 22RV1 (Kd = 204 nM) and VCaP (Kd = 358 nM) Sequence is regular RNA: GGCUUUCGGGCUUUCGGCAACAUCAGCCCCUCAGCC
5'-dGpdGpdCpdUpdUpdUpdCpdGpdGpdGpdCpdUpdUpdUpdCpdApdApdCpdApdUpdCpdApdGpdCpdCpdCpdCpdUpdCpdApdGpdCpdCp-3'
33

Note: Information on this aptamer oligo was obtained from the literature and hasn't been validated by Aptagen.

Powell Gray B, Kelly L, Ahrens DP et al. Tunable cytotoxic aptamer-drug conjugates for the treatment of prostate cancer. Proc. Natl. Acad. Sci. U.S.A. doi: 10.1073/pnas.1717705115 (2018)

Have your aptamer oligo synthesized by one of our AFFILIATES

Community Feedback

Forget Antibodies. Use Aptamers!™ Forget Antibodies. Use Aptamers!™