Aptamer Details

Aptamer 1.12 (ID# 545)

Aptamer 1.12
DNA Ochratoxin A (OTA) Protein 0.36 µM (reported value) Selection Buffer (SB): 10mM HEPES, pH 7.0, 120mM NaCl, 5mM KCl, 5mM MgCl2 °C Heat to 90C for 5 minutes, followed by 30 minutes at room temperature. Equilibrium dialysis of 100nM OTA in selection buffer showed approximately 95% binding to Aptamer 1.12 at an aptamer concentration of 10uM. Addition of 20nM NAP or 20nM warfarin to the mix had no significant effect on the binding of OTA to aptamer. With the same conditions as OTA, OTB (Ochratoxin B) 30NT Random Region: GCATCTGATCGGGTGTGGGTGGCGTAAAGG , Forward Primer: Cy3-TGGTGGCTGTAGGTCA , Reverse Primer: Biotin-CGTTGTCCGATGCTC
5'dTpdGpdGpdTpdGpdGpdCpdTpdGpdTpdApdGpdGpdTpdCpdApdGpdCpdApdTpdCpdTpdGpdApdTpdCpdGpdGpdGpdTpdGpdTpdGpdGpdGpdTpdGpdGpdCpdGpdTpdApdApdApdGpdGpdGpdApdGpdCpdApdTpdCpdGpdGpdApdCpdApdApdCpdGp3' 61 19102.42 g/mole 597700 L/(mole·cm) 59.02% 1.67 31.96

Note: Information on this aptamer oligo was obtained from the literature and hasn't been validated by Aptagen.

Jorge A. Cruz-Aguado, Gregory Penner, "Determination of Ochratoxin A with a DNA Aptamer", J. Agric. Food Chem. (2008), 56, 10456-10461.

Have your aptamer oligo synthesized ORDER NOW

Community Feedback