Forget Antibodies. Use Aptamers!™ Forget Antibodies. Use Aptamers!™
R&D Inquiry Quote
Contact Us

Apta-Index™: Aptamer 1.12 (ID# 545)

Back to Search Results

Aptamer 1.12 (ID# 545)

Aptamer 1.12
* The secondary structure may not be accurate because of MFOLD limitations on chemistries other than RNA/DNA.
DNA Ochratoxin A (OTA) Protein 0.36 µM (reported value) Selection Buffer (SB): 10mM HEPES, pH 7.0, 120mM NaCl, 5mM KCl, 5mM MgCl2 Heat to 90C for 5 minutes, followed by 30 minutes at room temperature. 30NT Random Region: GCATCTGATCGGGTGTGGGTGGCGTAAAGG , Forward Primer: Cy3-TGGTGGCTGTAGGTCA , Reverse Primer: Biotin-CGTTGTCCGATGCTC
5'-dTpdGpdGpdTpdGpdGpdCpdTpdGpdTpdApdGpdGpdTpdCpdApdGpdCpdApdTpdCpdTpdGpdApdTpdCpdGpdGpdGpdTpdGpdTpdGpdGpdGpdTpdGpdGpdCpdGpdTpdApdApdApdGpdGpdGpdApdGpdCpdApdTpdCpdGpdGpdApdCpdApdApdCpdGp-3'
61 19102.42 g/mole 597700.00 L/(mole·cm) 59.02% 1.67 31.96

Note: Information on this aptamer oligo was obtained from the literature and hasn't been validated by Aptagen.

Jorge A. Cruz-Aguado, Gregory Penner, "Determination of Ochratoxin A with a DNA Aptamer", J. Agric. Food Chem. (2008), 56, 10456-10461.

Have your aptamer oligo synthesized by one of our AFFILIATES

Community Feedback

Forget Antibodies. Use Aptamers!™ Forget Antibodies. Use Aptamers!™